DNA sequence encoding N-acetyl-galactosamine-transferase

by: Lowe, John B.; Smith, Peter L.;

.beta.1,4-N-acetyl-galactosamine-transferase catalyzes the addition of N-acetyl-galactosamine in .beta.1,4-linkage to subterminal galactose substituted with an .alpha.2,3-linked N-acetyl-neuraminic acid residue.

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates to a novel cloned cDNA sequence that encodes a UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R(1,4) N-acetyl-galactosamine-transferase, its derived protein sequence, other protein and DNA sequences that are derived from the initial cloned sequences, monoclonal antibodies which specifically bind to such enzymes, immunoassays for detecting and/or quantitating such enzymes, plasmids or vectors which contain such a DNA sequence, cells which have been transfected with such a plasmid or vector, and a method of producing such an enzyme by culturing such a transformed cell.

2. Discussion of the Background

CT1 and CT2 are IgM class monoclonal antibodies isolated for their ability to block specific target lysis by a murine cytotoxic T lymphocyte (CTL) clone (Lefrancois, L., et al, Nature, Vol. 314, pp. 449-452 (1985); Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985)). These antibodies recognize overlapping but not identical neoantigenic determinants present on activated cytolytic T-cells, but not on naive populations of T lymphocytes (Lefrancois, L., et al, Nature, Vol. 314, pp. 449-452 (1985); Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985); Lefrancois, L., et al, J. Exp. Med., Vol. 162, pp. 1275-1293 (1985)). Both antibodies strongly stain a variety of independently derived cytotoxic T-lymphocyte cell lines, but do not stain T cell lines of a non-cytolytic phenotype (Lefrancois, L., et al, Nature, Vol. 314, pp. 449-452 (1985); Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985)). Neither antibody recognizes naive T-cell populations in the spleen, thymus, lymph node, or bone marrow (Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985)). However, both antibodies stain intraepithelial lymphocytes (IEL) (Lefrancois, L., J. Immunol., Vol. 138, pp. 3375-3384 (1987); Goodman, T. G., et al, J. Immunol., Vol. 145, pp. 2959-2966 (1990)), which represent constitutively activated lymphocytes that reside in the intestinal mucosa (Goodman, T., et al, Nature, Vol. 333, pp. 855-858 (1988)). Naive splenic T-cells do not express CT reactive determinants, but become CT-positive when induced to generate cytotoxic lymphocytes in mixed lymphocyte cultures (MLC) (Lefrancois, L., et al, Nature, Vol. 314, pp. 449-452 (1985); Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985); Lefrancois, L., et al, J. Exp. Med., Vol. 162, pp. 1275-1293 (1985)). Studies using a T cell hybridoma that can be induced to become cytolytic have shown that the cytokine IL-2 is required for induction of both cytotoxicity and CT antigen expression. Likewise, depletion of IL-2 yields a parallel loss of the cytolytic phenotype and CT antigen expression, confirming a linkage between the activation state of CTL and CT epitope expression (Lefrancois, L., et al, J. Immunol., Vol. 136, pp. 1171-1177 (1986)). The major proteins immunoprecipitated from CTL cell lines by CT antibodies belong to the CD45 family of cell-surface transmembrane tyrosine phosphatases required for T-cell proliferation in response to antigen (Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985); Pingel, J. T., Cell, Vol. 58, pp. 1055-1065 (1989)).

In parallel studies, it had been shown that murine CTL can also be identified and separated from other lymphocytes by Vicia villosa agglutinin (VVA) (Kimura, A. K., et al,, J. Exp. Med., Vol. 149, pp. 473-484, (1979)), a lectin with nominal specificity for N-acetyl-galactosamine (GalNAc), (Goldstein, I. J., et al, in The Lectins; Properties, Functions, and Applications in Biology and Medicine, (Liener, I. E., Sharon, N., and Goldstein, I. J., Eds.) pp. 33-247, Academic Press, Orlando, Fla. (1986)). Through the use of a mutant murine CTL line, Conzelmann and Kornfeld demonstrated that the oligosaccharide structure recognized by VVA was dependent on an enzymatic activity capable of transferring GalNAc in .beta.1,4-linkage to galactose substituted .alpha.2,3 with sialic acid, on O- and N-glycosidically linked oligosaccharides (Conzelmann, A., et al, J. Biol. Chem., Vol. 259, pp. 12528-12535 (1984); Conzelmann, A., et al, J. Biol. Chem., Vol. 259, pp. 12536-12542 (1984)). The structure had been defined previously as one commonly known as the Sd.sup.a blood group (Donald, A. S. R., et al, Biochem. Biophys. Res. Comm., Vol. 115, pp. 625-631 (1983)). It was subsequently demonstrated that CT1 and CT2 monoclonal antibodies are capable of binding this epitope, thus defining the CT antibody epitope as, at least in part, the Sd.sup.a blood group oligosaccharide (Conzelmann, A., et al, J. Exp. Med., Vol. 167, pp. 119-131 (1988)).

The structure of the Sd.sup.a blood group was first delineated by Donald et al, as the endo-.beta.-galactosidase released pentasaccharide NeuAc.alpha.2,3(GalNAc.beta.1,4)Gal.beta.1,4GlcNAc.beta.1,3Gal, on Asn-linked oligosaccharides present on Tamm-Horsefall glycoprotein isolated from human urine (Donald, A. S. R., et al, Biochem. Biophys. Res. Comm., Vol. 115, pp. 625-631 (1983)). This structure is dependent on the addition of .beta.1,4-linked GalNAc to the 3'-sialyl-N-acetyl-lactosamine non-reducing terminus of the oligosaccharide (Serafini-Cessi, F., et al, Biochem. J., Vol. 215, pp. 483-489 (1983); Donald, A. S. R., et al, Biochem. Soc, trans., Vol. 15, pp. 606-608 (1987)). A GalNAc-transferase activity capable of forming this structure has been described in human kidney (Piller, F., et al, Carbohydrate Res., Vol. 149, pp. 171-184 (1986)), intestine (Malagolini, N., et al, Cancer Res., Vol. 49, pp. 6466-6470 (1989)), colon (Morton, J. A., et al, Immunol. Invest., Vol. 17, pp. 217-224 (1988)), urine (Serafini-Cessi, F., et al, Archives Biochem. Biophys., Vol. 266, pp. 573-582 (1988)) and blood plasma (Takeya, A., et al, J. Biochem., Vol. 101, pp. 251-259 (1987)), as well as in guinea pig kidney (Serafini-Cessi, F., et al, Biochem. J., Vol. 215, pp. 483-489 (1983); Dall'olio, F., et al, Bioscience Reports, Vol. 7, pp. 925-932 (1987)). These enzyme activities can transfer GalNAc to both N- and O-linked oligosaccharides present on fetuin and hCG, and demonstrate an absolute dependence on galactose substituted .alpha.2,3 with sialic acid. Interestingly, these enzyme activities are incapable of efficiently transferring GalNAc to the glycolipid GM3 (NeuAc.alpha.2,3Gal.beta.1,4Glc-Cer) despite the fact that they can efficiently use 3'-sialyl-lactose (NeuAc.alpha.2,3Gal.beta.1,4Glc) as a substrate (Piller, F., et al, Carbohydrate Res., Vol. 149, pp. 171-184 (1986); Serafini-Cessi, F., et al, Carbohydrate Res., Vol. 151, pp. 65-76 (1986)). Thus, the Sd.sup.a blood, group GalNAc-transferase can transfer GalNAc to the non-reducing terminal 3'-sialyl-lactose and 3'-sialyl-N-acetyl-lactosamine structures of Asn- and Ser/Thr-linked oligosaccharide structures to generate the Sd.sup.a blood group.

However, there remains a need for isolated enzymes which can generate the epitope recognized by the CT, as well as human anti-Sd.sup.a blood group antibodies. There also remains a need for DNA sequences which encode an enzyme which can generate the epitope recognized by the CT, as well as human anti-Sd.sup.a blood group antibodies. There also remains a need for monoclonal antibodies which specifically bind to such an enzyme and immunoassays for detecting and/or quantitating such an enzyme.

SUMMARY OF THE INVENTION

Accordingly, it is an object of the present invention to provide novel DNA sequences which encode an enzyme capable of generating the epitope recognized by CT1 or CT2.

It is another object of the present invention to provide novel DNA sequences which encode an enzymic capable of generating the epitope recognized by human anti-Sd.sup.a blood group antibodies.

It is another object of the present invention to provide plasmids or vectors which contain such a sequence of DNA.

It is another object of the present invention to provide cells transfected with such a plasmid or vector.

It is another object of the present invention to provide novel enzymes which are capable of generating the epitope recognized by the CT1 and CT2.

It is another object of the present invention to provide novel enzymes capable of generating the epitope recognized by human anti-Sd.sup.a blood group antibodies.

It is another object of the present invention to provide novel monoclonal antibodies which specifically bind to such enzymes.

It is another object of the present invention to provide novel immunoassays to detect and/or quantitate such enzymes.

It is another object of the present invention to provide a method for preparing such an enzyme by culturing a cell which has been transformed with such a vector or plasmid.

These and other objects, which will become apparent during the following detailed description, have been achieved by the inventors' cloning and expression of a murine cDNA from a cytotoxic T-lymphocyte cell cDNA library which encodes a UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R.beta.1,4 N-acetyl-galactosamine-transferase capable of generating the epitope recognized by the CT, as well as human anti-Sd.sup.a blood group antibodies.

BRIEF DESCRIPTION OF THE DRAWINGS

A more complete appreciation of the invention and many of the attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following detailed description when considered in connection with the accompanying drawings, wherein:

FIGS. 1A and 1A1 and 1B show the DNA (SEQ. ID NO:1) and derived protein sequence (SEQ. ID NO:2) of the cDNA insert in pCDM8-CT. The predicted amino acid sequence is displayed below the DNA sequence. The putative transmembrane domain (amino acid residues 18-32) is underlined. A schematic representation (FIG. 1B) of the cDNA insert and its predicted protein structure is depicted above the sequences (FIGS. 1A and 1A1). The protein coding region is denoted by a rectangular box. Untranslated sequences are depicted by simple lines. The putative cytosolic, transmembrane (T.M.), and golgi lumen portions of the predicted protein are indicated, and the size of each is listed immediately below in terms of the number of amino acids (a.a.). A single Ash-linked consensus sequence is shown at amino acid residue 389. bp=base pairs (nucleotides);

FIG. 2 shows the results of a Northern blot analysis of 14-7fd cells. 2 .mu.g of oligo-dT purified RNA isolated from 14-7fd cells was subjected to Northern blot analysis. The blot was probed with a radiolabeled Xho-I fragment representing the entire 1.6 kb insert in pCDM8-CT. RNA molecular size standards are indicated on the left (in kilobases);

FIG. 3 illustrates the results of the flow cytometry analysis of pCDM8-CT transfected CHO-Tag cells. CHO-Tag cells were transfected with either the expression vector pCDM8-CT (hashed bars) or the control vector (pCDM8; solid bars) alone. After a 68 hour expression period, cells were harvested and subjected to flow cytometry analysis with the monoclonal antibodies or lectin indicated, using methods detailed in the Examples below. The data represent the percentage of cells staining more intensely than an arbitrary limit determined from cells stained with FITC conjugated goat anti-mouse IgM alone;

FIG. 4 shows the results of .beta.1,4-N-acetyl-galactosamine-transferase assays of pCDM8-CT transfected CHO-Tag cells. CHO-Tag cells were transfected with either pCDM8-CT or pCDM8 alone. After a 68 hour expression period, crude microsomal fractions were isolated and assayed for .beta.1,4-N-acetyl-galactosamine-transferase activity as described in the Examples below. Assays using microsomes prepared from pCDM8-CT and pCDM8 transfected CHO-Tag cells are shown as hatched bars and solid bars, respectively. All acceptors were present at a concentration of 80 .mu.M 3'-sialyl-N-acetyl-lactosamine or N-acetyl-lactosamine (for iminobiotinylated fetuin and asialo-fetuin this was an estimate based on data presented by Green et. al.) (Green, E. D., et al, J. Biol. Chem., Vol. 263, pp. 18253-18268 (1988)). The donor nucleotide sugar was present at a concentration of 20 .mu.M (1 nmole);

FIGS. 5A and 5B shows the partial nucleotide and amino acid sequence comparison between the CT-GalNAc-transferase cDNA and a cDNA encoding the human GM2/GD2 synthase (Nagata Y., et al, J. Biol. Chem., pp. 12082-12089 (1992)). The nucleotide and amino acid alignment was generated using the GAP program of the University of Wisconsin Genetics Computer Group (Devereux, et. al. 1984), using a gap weight of 5.0 and a length weight of 0.3. The figure shows only the sequence corresponding to nucleotides 336-1421 of the CT-GalNAc-transferase of the present invention (mCT) (SEQ. ID NO:3) and 373-1497 of the human GM2/GD2 synthase (hGM2) (SEQ. ID NO:5) and their translated amino acid sequences (SEQ. ID NOS:4 and 6, respectively), as these segments correspond to the regions where the two are most homologous. The complete nucleotide sequence of the CT-GalNAc-transferase corresponding to this region is displayed, while only nucleotides that are not identical to the CT-GalNAc-transferase are listed for the human GM2/GD2 synthase. The complete amino acid sequences for this region of both transferases is listed below the nucleotide sequence comparison. Amino acids that are identical between the two sequences are connected by "I". Gaps introduced in the nucleotide sequence and respective amino acid sequence, introduced to maximize alignments, are designated by ".". Two cytidines, missing in the published human GM2/GD2 nucleotide sequence (nucleotides 1296 and 1416 of the human GM2/GD2 sequence; see Examples below and FIGS. 6A and B are designated in bold type;

FIGS. 6A and B show the documentation of two additional cytidines in the nucleotide sequence of the human GM2/GD2 synthase. A 500-base pair DNA fragment was generated by the PCR from a human melanoma cell line (M21) cDNA library, and sequenced (see Examples below). (A) Autoradiograph of dideoxy DNA sequencing gel across the region corresponding to nucleotides 1233 to 1242, numbered according to the published sequence for the human GM2/GD2 synthase (Nagata Y., et al, J. Biol. Chem., pp. 12082-12089 (1992)). The additional base pair (C-G) is delineated by a box. The sequence of the plus strand (SEQ. ID NO:13) is shown on the right, while that of the minus strand is shown on the left. (B) DNA sequence across the region corresponding to nucleotides 1352 to 1361 of the human GM2/GD2 sequence, presented as described in (A); that is, the sequence of the plus strand (SEQ ID NO:14) is shown on the right while the sequence of the minus strand is shown on the left; and

FIG. 7 illustrates the results of the Southern blot analysis of murine genomic DNA. A pair of identical blots were prepared as described in the Examples below and probed under low stringency conditions with a Bsm I-Ear I fragment of pCDM8-CT corresponding to nucleotides 523-1040 (lanes 1-4) or a PCR-amplified product of the human GM2/GD2 synthase corresponding to nucleotides 580-1144 (lanes 5-8). These regions correspond to areas of highest sequence identity (58%) between these two cDNA's. Murine genomic DNA was digested with Bam HI (lanes I and 5), Hind III (lanes 2 and 6), Pst I (lanes 3 and 7), or Eco RI (lanes 4 and 8). Molecular weight markers are shown between the two blots in kilobases.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

Thus, in a first embodiment, the present invention provides novel DNA sequences which encode an enzyme capable of generating the epitope recognized by the CT1 and CT2, as well as human Sd.sup.a blood group antibodies. Suitably, the present DNA sequence is any which encodes the amino acid sequence shown in FIG. 1a. More preferably, the DNA sequence is any which encodes a protein having the sequence corresponding to from position 1 to position 510 in the amino acid sequence shown in FIG. 1a.

Of course, the DNA sequence may encode a protein which corresponds to any of those described above but in which up to 34 amino terminal amino acid residues have been added, deleted, or substituted, provided that the protein retains its activity. In this context a protein is considered to retain its activity if it retains at least 10%, preferably at least 1/3, more preferably at least 1/2 of the specific activity of the native enzyme to transfer GalNAc to the trisaccharide acceptor 3'-sialyl-N-acetyl-lactosamine as determined by the assay described in the Examples.

In a preferred embodiment, the DNA sequence has the nucleotide sequence shown in FIGS. 1A and 1A1. More preferably, the DNA sequence has the nucleotide sequence corresponding to from position 1 to position 1530 in the nucleotide sequence shown in FIG. 1a.

The cloning of the full length DNA sequence shown in FIG. 1b is described in great detail in the Examples below. The shorter length fragments of this sequence as well as the other DNA sequences of the present invention may be obtained by conventional techniques, such as solid state DNA synthesis, site-directed mutagenesis, or the polymerase chain reaction (Maniatis, T., et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)).

In another embodiment, the present invention provides novel enzymes capable of generating the epitope recognized by CT1 and CT2, as well as human Sd.sup.a blood group antigens. Suitably, the enzyme has the amino acid sequence shown in FIG. 1b. Alternatively, the enzyme has an amino acid sequence corresponding to from position 35 to position 510 in the amino acid sequence shown in FIG. 1b. As discussed above, the enzyme may also have one of the amino acid sequences described above and in which up to 34 amino terminal amino acid residues have been added, deleted, or substituted.

The present invention also provides novel fusion proteins in which any of the enzymes of the present invention are fused to a polypeptide such as protein A, streptavidin, fragments of c-myc, maltose binding protein, IgG, IgM, amino acid tag, etc. Preferably, the polypeptide fused to the present invention is fused to the amino terminus of the present enzyme. In addition, it is preferred that the polypeptide fused to the enzyme of the present invention is chosen to facilitate the release of the fusion protein from a prokaryotic cell into the culture medium.

In yet another embodiment, the present invention provides novel plasmids or vectors which contain a DNA sequence according to the present invention. The present plasmid may be either a cloning vector or an expression plasmid. Suitable plasmids or vectors are those obtained by inserting a DNA sequence of the present invention into a plasmid or vector such as pCDM8 pCDNA1, pREP8, pCEP4, pTZ18, etc. In the case of an expression plasmid, the DNA sequence of the present invention is preferably inserted into the plasmid downstream from a promoter and in the correct reading frame. The insertion of a DNA sequence according to the present invention into any conventional expression plasmid in the correct reading frame and the insertion of a DNA sequence of the present invention into a conventional cloning vector can easily be accomplished by the skilled artisan using conventional recombinant DNA technology.

The present invention also provides transformed cells which contain a plasmid or vector according to the present invention. Suitable host cells include any mammalian cell. Preferred host cells include Chinese hamster cells, COS cells, etc. The transformation of such host cells with a plasmid or vector according to the present invention may be carried out using conventional techniques (Maniatis, T., et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); and Conzelmann, A., et al, J. Exp. Med., vol. 167, pp. 119-131 (1988)).

In another embodiment, the present invention provides a method for producing an enzyme of the present invention by culturing in a culture medium a transformed cell according to the present invention for a time sufficient to produce the enzyme. Preferably, the cell has been transformed with an expression plasmid such as pCDM8-CT. Of course, the particular culture conditions, such as temperature, medium, etc., will depend on the type and identity of the transformed cell. However, the selection of appropriate conditions is well within the abilities of the skilled artisan. For example, suitable culture conditions and media for a variety of cell types are taught in Maniatis, T., et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), which is incorporated herein by reference.

In another embodiment, the present invention provides novel monoclonal antibodies which specifically bind to the present enzymes. Such monoclonal antibodies may be produced using conventional methods such as described in Harlow, et al, Antibodies. A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1988), which is incorporated herein by reference. The present antibodies may be labelled with any conventional label, such as a radiolabel, a chromophore (e.g., a fluorescent label), or an enzyme (e.g., horseradish peroxidase).

The present invention also provides novel immunoassays for the detection and/or quantitation of the present enzymes in a sample. The present immunoassays will utilize one or more of the present monoclonal antibodies which specifically bind to the present enzymes. The present immunoassay may be a competitive assay, a sandwich assay, or a displacement assay, such as those described in Harlow, et al, Antibodies. A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1988) and Ausebel, F. M., et al, Current Protocols in Molecular Biology, John Wiley and Sons, NY (1989) and may rely on the signal generated by a radiolabel, a chromophore, or an enzyme.

The DNA sequences, enzymes, plasmids, cells, and methods of the present invention have a number of uses. Thus, the present invention provides a previously undiscovered DNA sequence that encodes a specific and a heretofore undiscovered protein sequence capable of functioning as a UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R.beta.(1,4) N-acetyl-galactosamine-transferase. This enzyme, when expressed by the cloned DNA sequence described here, has been shown to function within mammalian cells to generate de novo expression of specific cell surface glycoconjugate structures on those cells. These structures are recognized by antibodies that recognize the terminal oligosaccharide epitope NeuAc.alpha.2,3(GalNac.beta.1,4)Gal.beta.-R. This enzyme, when expressed by the cloned DNA sequence described here, has also been shown to function in the enzymatic manner implied in its name, when assayed in extracts prepared from cells that express the DNA sequence. The oligosaccharide products of this enzyme represents N-acetyl-galactosamine linked in beta 1,4 configuration to the galactose residue of a "type II" 3'-sialyl-N-acetyl-lactosamine acceptor (hereinafter referred to as sub-terminal B(1,4) GalNAc residues). This reaction is shown in the equation below: ##STR1##

The product may also be written as

NeuNAc.alpha.(2,3)›GalNAc.beta.(1,4)!Gal.beta.1,4GlaNAc-R

wherein R is a N-linked or O-linked oligosaccharide moiety or backbone.

Specific utilities of the various embodiments of the present invention include:

i. Construction of animal cell lines with specific capabilities with respect to post-translational modification of the oligosaccharides on cell-surface, intracellular, or secreted proteins or lipids with sub-terminal .beta.(1,4) GalNAc residues that represent the products of this enzyme (for the production of diagnostics and therapeutics by the biotechnology industry). Specifically, the cloned DNA sequence described here can be introduced by conventional techniques into a mammalian cell line that does not normally express the cognate enzyme or its product (sub-terminal .beta.(1,4) GalNAc residues on oligosaccharides), and transcribed in that cell in the "sense" direction, to yield a cell line capable of expressing sub-terminal .beta.(1,4) GalNAc residues on oligosaccharides on cell-surface, intracellular, or secreted proteins or lipids.

Alternatively, this cloned DNA sequence can be introduced by conventional techniques into a mammalian cell line that does express the cognate enzyme and its product (subterminal .beta.(1,4) GalNAc residues) and transcribed in that cell in the "antisense" direction, to yield a cell line incapable of expressing sub-terminal .beta.(1,4) GalNAc residues on cell-surface, intracellular, or secreted proteins or lipids. The introduction and "antisense" expression of the present DNA sequences may be carried out as described in Maniatis, T., et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). The endogenous UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase gene(s), in a mammalian cell expressing the cognate enzyme(s), can be inactivated with the DNA sequence described here by homologous recombination techniques, or by "anti-sense" oligonucleotide approaches based upon the DNA sequence described herein, or by dominant negative mutant N-acetyl-galactosaminyltransferase sequences that inactivate endogenous UDP-GaINAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase(s) and that may be derived via mutagenesis and genetic selection techniques.

In this way, it is possible to construct animal cell lines that are suitable host cells for the production of diagnostic or therapeutic materials whose usefulness or efficacy depends upon the specific post-translational modification determined by this cloned DNA sequence and its cognate enzyme. For example, it is known that the biological effectiveness of many therapeutic proteins or peptides, recombinant or otherwise, can depend critically upon the oligosaccharide structure(s) that are covalently attached to them. The structure of these oligosaccharides is primarily a function of the number and kind of glycosyltransferase enzymes that are found in the cell used to produce these therapeutic products. Animal cells and yeasts are competent to perform these glycosylation reactions; however, not all glycosyltransferase enzymes are produced by every animal cell or yeast, and therefore, some oligosaccharide structures (including sub-terminal .beta.1,4-GalNAc residues generated by the present enzymes encoded by the present DNA sequences) are not produced by them.

The converse is also true, namely, that producing cells may express a glycosyltransferase analogous to, or identical to, the present UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosaminetransferase encoded by the present DNA sequences. The presence of Sub-terminal .beta.(1,4) GalNAc residues alters the bioactivity of natural or recombinant therapeutic or diagnostic agents (glycoproteins or glycolipids) produced by mammalian or other eukaryotic hosts. Eukaryotic host cells used to produce these recombinant agents can be altered to add sub-terminal .beta.1,4-GalNAc residues to the oligosaccharides on a recombinant product by expressing all or part of the present DNA sequences described here in the desired host. Alternatively, sub-terminal .beta.(1,4) GalNAc residues may be eliminated from the product produced in these host cells by the use of transfected "anti-sense" vector constructs, recombination-based gene inactivation, "anti-sense" oligonucleotide approaches, or dominant negative mutant fucosyltransferases, outlined above.

Conventional methods for obtaining a product having a particular oligosaccharide residue include an empirical approach to identify a cell line that does or does not express a particular enzyme or an enzyme that functions in a similar or identical manner, for the production of the appropriately modified recombinant or natural product. This is not always optimal since cell lines with a particular post-translation modification capability may not exist naturally, or may not be especially suited to high level production of an appropriately modified product. Unwanted sub-terminal .beta.(1,4) GalNAc residues present on a therapeutic material produced by an empirically identified animal cell line must be removed chemically or enzymatically, a process that may be costly or inefficient.

The advantages of using the present DNA sequence in conjunction with the techniques outlined above, relative to these older methods, include the ability to construct lines that specifically lack the capability to generate sub-terminal .beta.(1,4) GalNAc residues on the oligosaccharides of glycoproteins (and possibly glycolipids). Properly constructed, these cell lines will eliminate any need for chemical or enzymatic treatment of a therapeutic or diagnostic material to remove unwanted sub-terminal .beta.(1,4) GalNAc residues. Moreover, when sub-terminal .beta.(1,4) GalNAc residues are desirable for a particular diagnostic or therapeutic product produced by animal cells, cell lines may be engineered with the cloned DNA sequence described here to generate these residues.

ii. Isolation of reagents suitable for efficient enzymatic synthesis and production of oligosaccharides (in enzyme reactors, for example).

Oligosaccharides may be used as immunomodulatory reagents in the field of organ transplantation. In particular, soluble and solid-phase oligosaccharides may block or ameliorate antibody-mediated organ transplant rejection in cases involving incompatibility due to differences in the major blood group antigen systems of the organ donor and the recipient, including the Sd.sup.a blood group system (the oligosaccharide structure generated by the UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase enzyme is identical to the human Sd.sup.a blood group antigen).

Likewise, soluble oligosaccharides may be used as therapeutic agents that function by blocking attachment of bacterial, viral, or parasitic pathogens to glycoconjugate "receptors" found on the surface of the animal tissues that these pathogens invade. For example, the precursor oligosaccharide structure, which serves as a substrate for the UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase, (namely 3' sialyl-N-acetyl-lactosamine on Asn- and Ser/Thr-linked oligosaccharides) also serves as a "receptor" for some forms of uropathogenic bacteria. This interaction may be inhibited by modification of this structure by the addition of sub-terminal .beta.(1,4) GalNAc residues.

Moreover, glycoconjugates, including sub-terminal .beta.(1,4) GalNAc residues modulate adhesive events between cells, and between cells and their environment during developmental and differentiation processes. These events include homing of pro-thymocytes to the thymus or involvement in modulating ontological events of prothymocytes within the thymus. In addition, the sub-terminal .beta.(1,4) GalNAc residues have been shown to be largely associated with the CD45 family of T-cell surface tyrosine-phosphatases. This family is required for the proliferation of T-cells in response to foreign antigen stimulation. Furthermore, in chimeric protein experiments involving these molecules it has been shown that the catalytic activity of this molecule is constitutively functional unless the extra-cellular domains of adjacent molecules are cross-linked together, in which case the catalytic activity of the CD45 molecule is down regulated and the T-cell is no longer able to proliferate in response to antigen stimulation. The proliferative ability of T-lymphocytes may be controlled by effecting the down regulation of CD45 by the addition of sub-terminal .beta.(1,4) GalNAc residues to oligosaccharides on CD45 isoforms which result in the interaction with specific receptor molecules. Alternatively, addition of such sub-terminal .beta.(1,4) GalNAc residues to oligosaccharides on CD45 isoforms will block recognition of the CD45 molecules by otherwise down-modulating counter-receptors, and thus operate to maintain constitutively expressed CD45 activity. Thus, the present GalNAc-transferase sequence may be used to construct oligosaccharide-type molecules, capable of disrupting, maintaining, or otherwise modulating the function of normal, or perhaps even malignant, T-lymphocytes.

Currently, oligosaccharides are produced by chemical synthesis (a procedure that is inefficient and costly) or by isolation from natural sources (using costly and inefficient procedures that often require the processing of large quantities of animal or plant material, and the purification of the desired oligosaccharide from other contaminating oligosaccharides). The present invention provides a mechanism to synthesize abundant quantities of purified UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase, which may be used to construct an enzyme bioreactor (enzyme in solution or immobilized on a solid phase matrix, for example via the protein-A moiety fused to the catalytic domain of the enzyme, as described in the Examples capable of enzymatic synthesis of structures containing sub-terminal .beta.(1,4) GalNAc residues.

The use of the present enzyme is more efficient than approaches involving chemical synthesis of structures containing sub-terminal .beta.(1,4) GalNAc residues or their purification from natural sources, for a variety of reasons. One, the only chemicals necessary would be the enzyme substrates; these are easily obtained or synthesized. Two, enzymatic synthesis of such structures produce only the desired product and the nucleotide diphosphate product of substrate hydrolysis. This latter chemical is found as the natural byproducts of these reactions in animal cells, is relatively non-toxic, and is easily separated from the oligosaccharide synthetic product. By contrast, chemical synthetic procedures typically generate numerous products of side reactions which must be removed, and which may be toxic as well. Similarly, purification of oligosaccharides from natural sources requires the removal of other contaminating oligosaccharides present in the natural material. Three, enzymatic catalysis is extraordinarily efficient; nearly complete conversion of substrate to product may be achieved. By contrast, chemical synthesis of sub-terminal .beta.(1,4) GalNAc residues on oligosaccharides is a multi-step process; yields at each step may be much less than 100%, and the cumulative efficiency of current chemical synthesis procedures does not approach the efficiency possible with enzymatic synthesis.

Similarly, purification of oligosaccharides with sub-terminal .beta.(1,4) GalNAc residues from natural materials can entail significant losses inherent to the purification procedures required to separate the desired oligosaccharide from contaminating, irrelevant oligosaccharides, with inefficient isolation of the desired oligosaccharide. Although the UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase encoded by the present DNA sequences may be partially purified from animal tissues for synthetic use, these purifications are themselves inefficient, primarily because the enzyme is typically present in very low abundance.

The present invention provides two methods for the abundant production of this enzyme. First, this may be done through the construction and selection of animal cells that produce relatively large quantities of the enzymes. Alternatively, the present DNA sequences may be used with conventional recombinant DNA technologies to produce large quantities of the present glycosyltransferases in yeasts or in prokaryotic hosts. Furthermore, the present DNA sequence may be modified via standard molecular cloning schemes or mutagenesis to yield a recombinant fucosyltransferase with novel properties that make it more desirable than the wild-type enzyme. For example, the modifications might be made to the enzyme that make it more stable, or more suitable for immobilization in a bioreactor.

iii. Isolation of reagents suitable for producing recombinant UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase to be used directly as a research reagent, or to be used to generate antibodies against the UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase, for research applications.

The present invention provides two methods for producing large quantities of this enzyme (see ii. above--i.e. specially constructed animal cells, or via natural or synthetic genes encoding these enzymes) which may be used as a research tool with which to study the structures and functions of oligosaccharides and glycoproteins. Likewise, the enzyme produced by this method, or the nucleic acid sequence and derived protein sequence provided by this method, may be used to generate antibodies to this enzyme (via synthetic peptides). These antibodies might also be used as research reagents to study the biosynthesis and processing of these enzymes, and might be used as an aid in their purification for all the uses described in this disclosure.

iv. Recombinant enzyme for use in screening natural and synthetic compounds for fucosyltransferase inhibitors or inactivators.

There may be an association between the numbers of cell surface sub-terminal .beta.(1,4) GalNAc residues on oligosaccharides of a cell and the ability of that cell to metastasize in a malignant fashion. If there is a causal relationship here, drugs that inhibit the present enzyme may be used as antitumor agents. The present enzyme may be used for screening compounds for anti-GalNAc transferase activity, since the cloned sequence may be used with standard techniques to produce relatively large amounts of pure GalNAc transferase. This will aid in screening, since the effects of potential inhibitors will be tested on a pure enzyme, without the confounding effects that may occur in whole cell extracts or with partially purified enzyme.

v. Engineering of glycosyltransferase substrate specificity to generate novel glycoconjugate structures on secreted or cell-associated glycoconjugates.

The present cloned UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase cDNA may be used to generate mutant UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferases that generate glycosidic linkages different from that generated by the wild-type enzyme. These novel linkages may or may not be naturally occurring, and may enhance bioactivity of the molecules to which they are attached. Alternatively, mutagenesis and selection approaches may be used to generate mutant UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase that act in a dominant negative fashion. The dominant negative mutants so generated might be used to inactivate endogenous glycosyltransferase activities when the product(s) of such an enzyme are not desired. Mutant UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.(1,4) N-acetyl-galactosamine-transferase might also be generated, for example, that function as N-acetyl-galactosminyltransferases that hydrolyze various sugar linkages (GalNAc, Gal, GlucNAc, fucose, mannose, or others) from oligosaccharides in vitro and in vivo.

vi. Genotyping individuals at this GalNAc transferase locus.

Absence of a GalNAc-transferase similar or identical to the one encoded by the CDNA sequence detailed here has been found in several families. Restriction fragment length polymorphisms within or linked to the gene corresponding to this cloned gene segment may be used to genotype individuals at this locus, for the purpose of genetic counseling. Likewise, the molecular basis for any detrimental phenotypes might be elucidated via the study of the gene segment described here, should it be causally-related to such phenotypes.

The present invention will now be described in more detail in the context of the cloning of the full length cDNA fragment shown in FIG. 1a. However, it should be understood that this description is not limiting.

The monoclonal antibodies CT1 and CT2 were originally selected by virtue of their ability to block the cytolytic activity of a murine CTL cell line (Lefrancois, L., et al, Nature, Vol. 314, pp. 449-452 (1985)). These antibodies react with several T-lymphocyte cell lines with a cytotoxic phenotype, but not with helper T-lymphocytes (Lefrancois, L., et al, Nature, Vol. 314, pp. 449-452 (1985); Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985); Lefrancois, L., et al, J. Exp. Med., Vol. 162, pp. 1275-1293 (1985)). Characterization of the epitope(s) recognized by these antibodies indicate that they can recognize, as a minimal structure, specific oligosaccacharide molecules displayed by Asn- and Ser/Thr-linked oligosaccharides (NeuAc.alpha.2,3(GalNAc.beta.1,4)Gal.beta.1,4-R) (Conzelmann, A., et al, J. Exp. Med., Vol. 167, pp. 119-131 (1988)). However, the epitopes recognized by the CT1 and CT2 antibodies are not identical, in that the CT1 antibody can block CT2 binding, but not vice versa (Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985)), suggesting the possible involvement of additional determinants beyond this trisaccharide structure. Other biochemical analyses indicate that the bulk of these epitopes are displayed at the surface of CTL by various isoforms of the CD45 (T200) molecule (Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985)), a transmembrane glycoprotein whose cytosolic domain maintains tyrosine phosphatase activity required for antigen-dependent T-lymphocyte proliferation (Pingel, J. T., Cell, Vol. 58, pp. 1055-1065 (1989)).

The present inventors have now isolated a cloned cDNA corresponding to the regulated UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.1,4-R .beta.1,4-N-acetyl-galactosamine-transferase activity that catalyzes the enzymatic conversion of constitutively expressed precursor oligosaccharides to the CT epitope(s). Sequence analysis of the cDNA indicates that it encodes a 58 kDa protein with a predicted type II membrane topology characteristic of glycosyltransferases. Gene fusion experiments confirm that this cDNA encodes .beta.1,4-N-acetyl-galactosamine-transferase activity that constructs epitopes recognized by the CT antibodies.

Sequence analysis of the enzyme indicates that it shares a substantial amount of protein sequence similarity with the human GM2/GD2 synthase (Nagata Y., et al, J. Biol. Chem., pp. 12082-12089 (1992)). This is perhaps not surprising since GM2/GD2 synthase also transfers GalNAc from the nucleotide sugar donor UDP-GalNAc to oligosaccharide precursors terminating in NeuAc.alpha.2,3Ga.beta.1,4-R moieties. Additional glycolipid structures have been described that possess a terminal trisaccharide motif ›NeuAc.alpha.2,3(GalNAc.beta.1,4)Gal.beta.1,4! virtually identical to the Sd.sup.a structure or GM2. These structures include GalNAc-GM1b (Itoh, T., et al, J. Biol. Chem., Vol. 256, pp. 165-169 (1981)), GalNAc-GD1a (Svennerholm, L., et al, J. Biol. Chem., Vol. 248, pp. 740-742 (1973)), and GalNAc-sialylparagloboside (Gillard, B. K., et al, Biochemistry, Vol. 27, pp. 4601-4606 (1988)). As noted above, the CT1 and CT2 antibodies can recognize an oligosaccharide structure that is identical to the human Sd.sup.a blood group determinant.

Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustrations of the invention and are not intended to be limiting thereof.

EXAMPLES

Methods

Cell lines.

The murine cytotoxic T-lymphocyte cell line, 14-7fd (Braciale, T. J., et al, J. Exp. Med., Vol. 153, pp. 910-923 (1981); Andrew, M. E., et al, J. Immunol, Vol. 132, pp. 839-844 (1984)) was obtained from Dr. Vivian Braciale (University of Virginia) and was propagated in Iscove's (Gibco) containing 10% heat-inactivated fetal bovine serum (Hyclone), 5% mouse concanavalin A supernatant (Braciale, T. J., et al, J. Exp. Med., Vol. 153, pp. 910-923 (1981)), and antibiotics. CHO-Tag cells were constructed by co-transfecting CHO Ade-C cells with 20 .mu.g of Bam HI linearized pSVE-Bla (Muller, W. J., et al, Mol. Cell. Biol., Vol. 4, pp. 2406-2412 (1984)), containing the polyoma T-antigens, and Eco-RI linearized pSV2-Neo (Southern, P. J., et al, J. Mol. Appl. Genet., Vol. 1, pp. 327-341 (1982)) in a 10:1 ratio, using a calcium phosphate procedure (Chen, C., et al, Mol. Cell. Biol., Vol. 7, pp. 2745-2752 (1987)). After selection for G-418 resistant colonies, cells containing the polyoma large T-antigen were identified by immunofluorescence using an anti-polyoma large T-antigen murine monoclonal antibody (Oncogene Sciences, Seattle) (Dilworth, S. M., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 79, pp. 1059-1063 (1982)). Individual clones were further characterized for their ability to replicate exogenously introduced plasmid DNA by transfecting them (see below) with pCDM8-chloramphenicol acetyl-transferase (pCDM8-CAT), and subjecting them to Southern blotting after restriction enzyme digestion with Dpn I or Mbo I (Hefferman, M., et al, Nucleic Acids Res., Vol. 19, pp. 85-92 (1991)). Plasmids replicating within CHO-Tag cells are resistant to restriction with Dpn I and sensitive to Mbo I, whereas, bacterially replicated plasmid shows the opposite pattern of sensitivity to these two enzymes. CAT enzyme expression was determined in parallel using extracts prepared from the transfectants and a phase separation method with butyryl--Coenzyme A and .sup.3 H-Chloramphenicol as the substrates (Seed, B., et al, Gene, Vol. 67,pp. 271-277 (1988)). CHO-Tag cells were propagated in .alpha.-MEM (supplemented with deoxyribonucleotides and ribonucleotides; Gibco) containing 10% heat inactivated fetal bovine serum, 0.4 mg/ml G-418 (active drug; Gibco), penicillin, and streptomycin.

cDNA library construction.

An oligo-dT primed cDNA library was prepared from poly(A).sup.+ RNA isolated from 14-7fd cells, as previously described (Aruffo, A., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 94, pp. 8573-8577 (1987)), except the cDNA was ligated into the mammalian expression vector pCDM8 (Seed, B., Nature, Vol. 329, pp. 840-842 (1987)). The library contained 1.5.times.10.sup.7 independent recombinants with a mean insert size of approximately 1 kb.

Transfection of CHO-Tag cells.

CHO-Tag cells were tranfected using a commercially available transfection reagent (DOTAP, Boehringer-Mannheim), and either CsCl banded DNA (Maniatis, T., et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y. (1982)), or "mini-prep" DNA prepared using a commercially available kit (Magic Millipreps, Promega). Cells were plated 24 hours prior to transfection, at a density of 1.times.10.sup.6 cells per 100 mm plate. 2 .mu.g of plasmid DNA was mixed with 2 mls of serum-free .alpha.-MEM, and in a separate tube, 72 ml of DOTAP was mixed with 2 ml of serum-free .alpha.-MEM. The two solutions were subsequently combined, and incubated for 20 minutes at room temperature. The DNA/DOTAP/.alpha.-MEM solution was then added to cell monolayers that had been washed once with serum-free .alpha.-MEM, and the cells were returned to the incubator. Three hours later, 8 ml of serum-replete .alpha.-MEM was added. This media was removed 24 hours later, and was replaced with 10 ml of complete media. This procedure yielded a 30-35% transfection efficiency as assessed by flow cytometry of cells transfected with a cDNA encoding an .alpha.(1,3/1,4)-fucosyl-transferase (pCDM8-FTIII) (Kukowska-Latallo, J. F., et al, Genes & Dev., Vol. 4, pp. 1288-1303 (1990)) and stained with the antibody CSLEX (Fukushima, K., et al, Cancer Res., Vol. 44, pp. 5279-5285 (1984)). This same insert in the vector pCDM7 (Aruffo, A., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 94, pp. 8573-8577 (1987)), which does not contain the polyoma origin of replication, but does have the SV-40 origin of replication, yields a transfection efficiency of 11% after staining with the CSLEX antibody.

Preparation of panning dishes.

Bacterial petri dishes (60 mm, Falcon 1007) were coated with 4 ml of second antibody solution (10 mg/ml goat anti-mouse IgM, Sigma; in 50 mM Tris-HCl, pH 9.5) overnight at 4.degree. C. Plates were then washed with PBS, pH 7.3, containing 1 mM EDTA, and were subsequently blocked for 1 hour at room temperature with 1 mg/ml BSA in PBS. Plates were washed again with PBS/EDTA, and were coated with primary antibody by incubating with 0.5 ml of CT2 antibody (ascites) diluted 1:50 in staining media (DMEM, 2% fetal bovine serum, 10 mM HEPES, pH 7.5, and 0.1% sodium azide) for 30 minutes at 4.degree. C. Remaining unbound primary antibody was then removed by washing the dishes with staining media.

cDNA library screening.

Forty 100 mm plates were transfected with plasmid DNA prepared from an amplified portion of the library. After a 68 hour expression period, the cells were detached from the plate using 3 mM EDTA in PBS. After washing the cells with staining media, the resulting cell pellets were each resuspended in 2 ml of staining media and applied to a panning dish (.about.2.times.10.sup.7 cells/dish). The cells were allowed to settle onto the panning dishes, and were allowed to incubate there for 1 hour at 4.degree. C. Non adherent cells were then removed by washing the plates 4 times with 4 ml of PBS/1 mM EDTA. Plasmid DNA was rescued from the adherent cells using the Hirt supernatant method (Hirt, B., Mol. Biol., Vol. 26, pp. 365-369 (1967)), and introduced by electro-transformation into the E. coli host MC1061/P3 (Seed, B., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 87, pp. 3365-3369 (1987)). Plasmid DNA was prepared from these transformants and was subjected to two additional rounds of screening by the same procedure, except that only 10 plates were transfected on the third round. Panning-directed "sib" selection (Larsen, R. D., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 86, pp. 8227-8231 (1989)), starting from a pool of 500 bacterial colonies, was employed to isolate a single bacterial clone harboring a plasmid capable of directing transfected CHO-Tag cells to adhere to CT2 coated panning dishes.

Northern and Southern blotting

14-7fd cell poly (A).sup.+ RNA was subjected to Northern blot analysis using blotting and hybridization conditions described previously (Larsen, R. D., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 86, pp. 827-8231 (1989)). The probe consisted of the 1.6 kb Xho I insert isolated from pCDM8-CT, labeled (Feinberg, A. P. et al, Anal. Biochem., Vol. 132, pp. 6-13 (1983)) with ›.alpha.-.sup.32 P!dCTP to a specific activity of 1.times.10.sup.9 cpm/mg. The blot was subjected to three 10 minute washes in room temperature 2.times. SSC, and a 30 minute wash in 2.times. SSC, 0.2% SDS at 55.degree. C., and was then subjected to autoradiography.

Murine genomic DNA was prepared and subjected to restriction digestion as described previously (Ernst, L. K., et al, J. Biol. Chem., Vol. 264, pp. 3436-3447 (1989)). Genomic DNA restriction digests were fractionated by electrophoresis through 1.2% agarose gels, in a manner that yielded duplicate sets of fractionated digests, and the fractionated digests were transferred to Hybond-N (Amersham). The blot was then divided into two halves in such a manner that each contained identical sets of samples. One blot was probed with a Bsm I-Ear I fragment corresponding to nucleotides 523-1040 of the murine Sd.sup.a insert. The other was probed with a fragment corresponding to nucleotides 580-1144 of the human GM2/GD2 synthase cDNA (Nagata Y., et al, J. Biol. Chem., pp. 12082-12089 (1992)) isolated from a human melanoma (M21) cDNA library with the polymerase chain reaction (see below). These probes correspond to regions where these two sequences maintain optimal nucleotide sequence alignment. Both probes were labeled (Feinberg, A. P. et al, Anal. Biochem., Vol. 132, pp. 6-13 (1983)) with ›.alpha.-.sup.32 P!dCTP to a specific activity of 2.3.times.10.sup.9 cpm/mg. Blots were hybridized at 32.degree. C. for 16 hours in a hybridization solution described previously (Ernst, L. K., et al, J. Biol. Chem., Vol. 264, pp. 3436-3447 (1989)), were washed three times for 10 minutes in 2.times. SSC at room temperature, and were then washed for 30 minutes at 50.degree. C. in 2.times. SSC, 0.2% SDS. The blots were exposed to XAR5 for seven days, were subjected to an additional wash for 30 minutes at 65.degree. C. in 0.1.times. SSC, 0.5% SDS, and were again processed for autoradiography.

Flow cytometry analysis.

Transfected CHO-Tag cells were harvested after a 68 hour expression period, and were stained as previously described. Primary murine monoclonal IgM antibodies were diluted in staining media at the following concentrations: Anti-blood group H antibodies (Chembiomed Ltd., Edmonton, Alberta: 10 mg/ml), CT1 and CT2 (generously provided by Dr. Leo Lefrancois; 1:50 dilution of ascites) (Lefrancois, L., et al, J. Immunol., Vol. 135, pp. 374-383 (1985), 2A3D2 and 2D11E2 (generously provided by Dr. Reiji Kannagi; 1:100 dilution of purified ascites) (Hiraiwa, N., et al, Cancer Res., Vol. 50, pp. 5497-5503 (1990)). Cells were then stained with a fluorescein-conjugated goat anti-mouse IgM (Sigma; 40 mg/ml). Human anti-serum from Sd.sup.a blood group deficient individuals (Donald, A. S. R., et al, Biochem. Soc, trans., Vol. 15, pp. 606-608 (1987)) was generously provided by Dr. Winifred Watkins and was used at a dilution of 1:50. Cells stained with these latter serum were processed for flow cytometry using a mixture of fluorescein-conjugated goat anti-human IgG and fluorescein-conjugated goat antihuman IgM (Sigma; 40 mg/ml each). Vicia villosa (VVA) was used as a direct fluorescein-conjugate (EY labs; 2 mg/ml). All stained cells were subjected to analysis by flow cytometry on a FACScan (Bectin-Dickenson) as previously described (Kukowska-Latallo, et al, Genes & Dev., Vol. 4, pp. 1288-1303 (1990)).




Adjustable gage plate assembly Matte-finish polyurethane coating composition
Lather generator Braking system

DNA sequence analysis.

DNA sequencing was done with the dideoxy chain termination method (Sanger, F., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 74, pp. 5463-5467 (1977)) using a commercially available kit (USB) and synthetic oligonucleotide primers. DNA and protein sequence analysis was performed using the sequence analysis software package of the University of Wisconsin Genetics Computer Group (Devereux, J., et al, Nucleic Acids Res., Vol. 12, pp. 387-395 (1984)) and the MacVector version of the IBI Pustell Sequence Analysis Software package (IBI).

N-Acetyl-galactosamine-transferase assays.

Cultured cells or tissues were used to isolate crude microsomes. Tissues were disrupted with a polytron, and cultured cells were disrupted with a sonicator, in buffer C (30 mM Tris, pH=7.5, 120 mM potassium chloride, 5 mM magnesium acetate, 0.02% sodium azide) containing 0.25M sucrose. The homogenates were subjected to centrifugation at 1000.times.g for 20 minutes. The resulting supernatants were layered onto a cushion of 1.3M sucrose in Buffer C, and centrifuged for 3 hours at 120,000.times.g. Microsomes were collected from the 0.25M sucrose/1.3M sucrose interface, were diluted 5-fold with buffer C, and were pelleted. The resulting pellets were resuspended in 0.5 mls of 10 mM HEPES, pH 7.5, 20% glycerol, and were stored at -80.degree. C.

GalNAc-transferase assays were performed in 25 mM HEPES (pH 7.5), 20 mM MnCl.sub.2, 3 mM ATP, 10% glycerol, 85 mM GlcNAc, 0.03% Triton X-100, 20 mM UDP-›.sup.3 H!GalNAc (250,000 cpm), containing 88 .mu.g of either iminobiotinylated (Orr, G. A., J. Biol. Chem., Vol. 256, pp. 761-766 (1981)) fetuin (.about.4 nmoles terminal 3' sialic acid) or iminobiotinylated asialo fetuin, in a total volume of 50 ml. Assays were incubated for 90 minutes at 37.degree. C. and were terminated by the addition of 950 ml of wash buffer (50 mM NH.sub.4 CO.sub.3, pH=10.25, 0.5M NaCl). Each terminated assay was then centrifuged 5 minutes to remove precipitate, and was then applied to a 3 ml column of avidin-agarose (Pierce) that had been pre-equilibrated with 15 mls of wash buffer. The column was subjected to three 5 ml washes and was then eluted with 3 ml of elution buffer (50 mM ammonium acetate, pH 4.0, 0.5M NaCl). The eluate was mixed with 3 ml of water, and 36 ml of BioSafe II (RPI), and was subjected to scintillation counting. Fetuin and asialo fetuin (Sigma) were iminobiotinylated by resuspending them in 1 ml of 0.1M NaHCO.sub.3 at 10 mg/ml, adding 0.1 ml of 8 mg/ml NHS-iminobiotin (Pierce) dissolved in DMSO, and incubating overnight at 4.degree. C. The iminobiotinylated material was then dialyzed against two 1 liter changes deionized water, and was stored at -20.degree. C. until use.

Assays using low molecular oligosaccharides as substrates (3'-sialyl-N-acetyl-lactosamine, and lactosamine) were conducted exactly as described above, using 4 nmole of respective substrate, except that assays were terminated by adding 950 ml 5 mM NaH.sub.2 PO.sub.4 (pH 6.8). After a brief centrifugation, the supernatant was applied to a 3 ml column of Dowex 1X-8 (PO.sub.4 ; Biorad) that had been preequilibrated in 5 mM NaH.sub.2 PO.sub.4 (pH 6.8) (Paulson, J. C., et al, J. Biol. Chem., Vol. 252, pp. 2363-2371 (1977)). The column was eluted with 2 mls of the same buffer. All three mls were collected, mixed with 18 mls of BioSafe II, and subjected to scintillation counting.

Enzyme assay product analysis.

Enzyme product used for structural confirmation was prepared using 3'-sialyl-N-acetyl-lactosamine as the substrate, and assays conditions described above, except that the radiolabeled product in the Dowex column eluate was dried under vacuum, and desalted over P-2 in deionized H.sub.2 O. Aliquots (5000 cpms) were subjected to desialylation by hydrolysis in 2N acetic acid in a boiling water bath for varying lengths of time. The samples were then dried under vacuum. Residual acetic acid was eliminated from the samples by repeatedly resuspending them in water, and redrying them under vacuum. The product was then resuspended in water and subjected to ion-exchange HPLC on an AX-5 column as described (Baenziger, J. U., et al, Anal. Biochem., Vol. 112, pp. 357-361 (1981)), except that a 12 minute isocratic phase was incorporated prior to the commencement of the KPO.sub.4 ›?! gradient. Desialylated material eluted at 5 minutes, and monosialylated material eluted at 13 minutes. For preparative isolation of desialylated assay product, 50,000 cpms was subjected to acid hydrolysis for 45 minutes The material was then repeatedly dried under vacuum and resuspended in water, as described above, and a fraction was subjected to digestion with jack bean .beta.-hexosaminidase (Oxford Glycosystems) in 50 mM sodium citrate, pH 4.4, 0.02% sodium azide, for 96 hours at 37.degree. C. 0.3 units of the enzyme were added at the beginning of the digestion, and 0.15 additional units were added after 24 and 48 hours Release of ›.sup.3 H!GalNAc from the desialylated product was determined on an Aminex HPX-87H organic acid analysis HPLC column (Biorad) operated isocratically in 0.01N sulfuric acid (Green, E. D., et al, J. Biol. Chem., Vol. 260, pp. 5623-5630 (1985)). Undigested ›.sup.3 H!tetrasaccharide product eluted at 8 minutes, while 2N acetic acid-treated material eluted at 11 minutes, and ›.sup.3 H!GalNAc eluted at 15 minutes.

PCR amplification of human GM2/GD2 synthase fragments.

Two distinct regions of the human GM2/GD2 synthase cDNA were prepared by the PCR, using a cDNA library constructed with mRNA isolated from a human melanoma cell line (M21) (Mueller, B. M., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 87, pp. 5702-5705 (1990)). Primers were designed based on the published sequence for the human GM2/GD2 synthase (Nagata Y., et al, J. Biol. Chem., pp. 12082-12089 (1992)). The first region corresponds to nucleotides 520-1084 (upper strand primer (SEQ. ID NO:7): gcgcctcGAGGTATACCAGGTGAACCTGACTGCCTCC, corresponding to nucleotides 520-550, extraneous nucleotides in lower case, synthetic Xho I site underlined; lower strand primer (SEQ. ID NO:8): gcgctcgagTGAAGACGAAGTCGTCGTCCACCC, corresponding to the reverse complement of nucleotides 1061-1084, synthetic Xho I site underlined). The second region corresponds to nucleotides 1181-1692 (upper strand primer (SEQ. ID NO:9): gcgctcgagCCACTTATCGGCAGCTGCTGAGCGTGGAGC, corresponding to nucleotides 1181-1210, synthetic Xho I site underlined; lower strand primer (SEQ. ID NO:10): gcgcctcGAGTGCTCACAGGGTGGTGGGGTTTGTTGG, corresponding to the reverse complement of nucleotides 1663-1692, synthetic Xho I site underlined). PCR reactions contained 0.5 .mu.g of template DNA, 2.5 ng of each primer, 10 mM Tris-HCl, 50 mM KCl, 3 mM MgCl.sub.2, 10 mM DTT, 4 mM of each deoxynucleotide, and 0.5 units of Taq polymerase (Perkin-Elmer-Cetus). Thirty cycles of amplification were performed, consisting of 1.5 minutes at 94.degree. C., followed by an annealing step for 1 minute at 65.degree. C., and an extension for 1.5 minutes at 72.degree. C. The PCR product corresponding to nucleotides 520-1084 was digested with Xho I, gel purified, and cloned into the Xho I site of pCDM8. A representative plasmid was amplified and sequenced to confirm its identity. The product corresponding to nucleotides 1181-1692 was isolated in an identical manner, except that the fragment was independently generated three times. A cloned representative of each was sequenced. The three maintained identical sequences, indicating that each was free of any PCR-dependent mutation.

Construction and analysis of pPROTA-CT.sub.c.

A 1441-bp segment of the cDNA insert containing the putative GalNAc-transferase catalytic domain was isolated from pCDM8-CT by the PCR. PCR conditions were exactly as described above, except that 50 ng of pCDM8-CT plasmid DNA was used as the template, and the reactions were only cycled for 15 rounds, in order to prevent introduction of PCR-dependent sequence changes. PCR primers were chosen to amplify a segment corresponding to the enzyme's putative catalytic domain, and to allow the fragment to be cloned into the EcoRI site of the vector pPROTA (Sanchez-Lopez, R., et al, J. Biol. Chem., Vol. 263, pp. 11892-11899 (1988)) so as to yield a fusion protein consisting of the protein A segment of pPROTA, fused, in frame, to the coding region of the enzyme's catalytic domain. These primers correspond to nucleotides 100-129 (upper strand (SEQ. ID NO:11): cgcgaattcGGTGTCCCTTACAACAGACTTCAGCACC; extraneous nucleotides in lower case, synthetic Eco RI site underlined) and to nucleotides 1512-1541 (lower strand primer (SEQ. ID NO:12): cgcgaattcGGTACTTTTTAAGTGGAGCAGTAGAGATGG, reverse complement). The PCR product was digested with Eco RI, gel purified, and ligated into the Eco RI site of pPROTA. A representative plasmid containing a single insert in the appropriate orientation was designated pPROTA-CT.sub.c.

The plasmids pPROTA-CT.sub.c (pPROTA contains an SV-40 origin of replication and has a replication efficiency similar to that noted above for pCDM7 vectors) and pCDM8-CT were transfected into two 100 mm plates each of CHO-Tag cells as described above. After a 68 hour expression period, the medium (20 mls of each) was harvested, and clarified by centrifugation at 1000.times.g for 20 minutes to remove any residual cells. One aliquot of each supernatant was directly assayed for GalNAc-transferase activity. The remainder of each supernatant was used in IgG-Sepharose binding studies. IgG-Sepharose, or Sepharose 4B (0.5 ml packed volume each; Pharmacia) were pre-equilibrated by washing twice with 1 ml of TBS, 1 mg/ml BSA, 0.5% Triton X-100, and twice with 1 ml of TBS, 1 mg/ml BSA, in a batchwise manner. One half of each clarified supernatant was incubated overnight at 4.degree. C. with the equilibrated IgG-Sepharose or Sepharose 4B matrix. The matrices were then pelleted (400.times.g, 2'min) through 0.5 ml of 1M sucrose in TBS. The supernatant was removed and an aliquot was subjected to GalNAc-transferase assay ("unbound" fraction). The matrices were washed twice with 1 ml of TBS/BSA/Triton X-100, and then twice with 1 ml of TBS/BSA. The matrices were resuspended in an equal volume of TBS/BSA, and assayed directly for GalNAc-transferase activity ("bound" fraction). The adherent cells were harvested using 3 mM EDTA in PBS and pelleted. The cells were resuspended in 10 mM HEPES, 20% glycerol, were sonicated, and were centrifuged at 1000.times.g for 20 minutes to generate a post nuclear supernatant which was also assayed for GalNAc-transferase activity ("cell-associated" fraction).

Results

Expression Cloning Approach.

In order to isolate a cDNA encoding an enzyme capable of generating the oligosaccharide structure recognized by the CT antibodies, a gene transfer approach first developed for cloning cDNAs that encode cell surface proteins (Aruffo, A., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 94, pp. 8573-8577 (1987); Seed, B., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 87, pp. 3365-3369 (1987)), and adapted by us for the isolation of glycosyltransferase cDNA's (Kukowska-Latallo, et al, Genes & Dev., Vol. 4, pp. 1288-1303 (1990); Larsen, R. D., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 86, pp. 827-8231 (1989) was employed. This approach involves transfection of a mammalian cDNA expression library into a CT antigen-deficient cultured mammalian host cell capable of constructing the CT antigen upon introduction of a CT-GalNAc-transferase activity, followed by the rescue of cDNAs that determine expression of this cell surface oligosaccharide antigen.

The present GalNAc-transferase catalyzes the transfer of GalNAc from the donor nucleotide sugar substrate UDP-GalNAc to oligosaccharide substrates that terminate with 3-O-N-acetyl-neuraminic acid substituted galactose (i.e., 3'-sialyl-N-acetyl-lactosamine). Therefore, a suitable host cell line must synthesize both of these substrates, but must be devoid of any endogenous CT-GalNAc-transferase activity. In addition it must be capable of expressing exogenously introduced episomal DNA (containing CT-GalNAc-transferase-determining cDNAs) at sufficiently high levels to allow detection of the enzyme's cell surface oligosaccharide product. Chinese hamster ovary (CHO) cells fulfilled these requirements. CHO cells express Asn-and Ser/Thr-linked oligosaccharides that terminate almost exclusively with 3'-sialyl-N-acetyl-lactosamine (Smith, P. L., et al, J. Biol. Chem., Vol. 265, pp. 874-881 (1990)), and that represent the precursor oligosaccharide substrate of the CT-GalNActransferase (Conzelmann, A., et al, J. Biol. Chem., Vol. 259, pp. 12528-12535 (1984); Conzelmann, A., et al, J. Biol. Chem., Vol. 259, pp. 12536-12542 (1984); Conzelmann, A., et al, J. Exp. Med., Vol. 167, pp. 119-131 (1988); Conzelmann, A., et al, Biochem. J., Vol. 242, pp. 817-824 (1987)). Furthermore, they do not express any endogenous CT-GalNAc-transferase as assessed by in vitro enzymatic assay, nor do they express detectable levels of CT (or Sd.sup.a) antibody reactive material on their cell surface. It is known that CHO cells also synthesize UDP-GalNAc, as evidenced by the presence of Ser- and Thr-linked oligosaccharides, whose synthesis is dependent on UDP-GalNAc (Kingsley, D. M., et al, Cell, Vol. 44, pp. 749-759 (1986)). To insure high level expression of transfected expression cDNA libraries in the CHO host cells, we stably transfected our parental CHO cell line with a plasmid vector that encodes the polyoma large T-antigen (Hefferman, M., et al, Nucleic Acids Res., Vol. 19, pp. 85-92 (1991)). The resulting host cells (CHO-Tag) allow high level, episomal replication of expression vectors bearing the polyoma origin of replication (e.g. pCDM8) (Seed, B., Nature, Vol. 329, pp. 840-842 (1987)), and facilitate high expression levels of molecules encoded by such vectors, as well as rescue of such vectors by the Hirt supernatant procedure (Hirt, B., Mol. Biol., Vol. 26, pp. 365-369 (1967)).

Isolation of a cloned cDNA that determines expression of the CT2 epitope.

A murine CTL line, 14-7fd, has been shown to express large amounts of CT-GalNAc-transferase activity in an in vitro assay (Conzelmann, A., et al, Biochem. J., Vol. 242, pp. 817-824 (1987)). These results were confirmed using fetuin and the trisaccharide 3'-Sialyl-N-acetyl-lactosamine as substrates for transfer, using microsomes prepared from this cell line. This CTL line is also strongly reactive with both CT antibodies, as well as with human anti-Sd.sup.a serum, when analyzed by flow cytometry procedures. This cell line was therefore used as a source of mRNA for constructing a cDNA expression library in the expression vector pCDM8.

Plasmid DNA amplified from the 14-7fd cell library was transfected into CHO-Tag cells and the transfected cells were panned on petri dishes coated with the CT2 antibody. Plasmid DNA was rescued from adherent cells with the Hirt supernatant method (Hirt, B., Mol. Biol., Vol. 26, pp. 365-369 (1967)), was transformed into bacteria and amplified. This amplified plasmid DNA was transfected into CHO-Tag cells, and the transfected cells were again panned on petri dishes coated with the CT2 antibody. Plasmid DNA was rescued from adherent cells, transformed into bacteria, amplified, and subjected to a third round of transfection and selection by panning. Bacterial clones obtained with plasmid DNA rescued from this third round of panning were divided into several pools of clones comprised of between 50 to 2000 independent colonies. Plasmid DNA was prepared from each pool, and was separately transfected into CHO-Tag cells. The transfected cells were then tested for their ability to adhere to plates coated with the CT2 antibody. The plasmid DNA isolated from one 500 colony pool yielded CT2-adherent CHO-Tag cells after transfection. This pool was divided into several smaller pools, and plasmid DNAs prepared from these pools were separately tested for their ability to determine CT2-adherent phenotype in transfected CHO-Tag cells. This process was repeated until we identified a single plasmid clone, PCDM8-CT, that yielded a CT2-adherent phenotype when transfected into CHO-Tag cells.

The cDNA insert in pCDM8-CT predicts a type II transmembrane glycosyltransferase.

The cDNA insert in pCDM8-CT is 1624 nucleotides in length. It contains a single long open reading frame of 1533 bp that begins at a position compatible with the Kozak consensus sequence for translational initiation (FIGS. 1A and 1A1 and 1B) (Kozak, M., Cell, Vol. 44, pp. 283-292 (1986)). This assignment predicts a 41 bp 5'-untranslated region and a 50 base pair long 3'-untranslated region (FIG. 1). The open reading frame predicts a 510 amino acid protein with a calculated molecular weight of 58,313 daltons. Inspection and hydropathy analysis (Kyte, J., et al, J. Mol. Biol., Vol. 157, pp. 105-132 (1982)) of this polypeptide sequence predicts a type II transmembrane protein (Wickner, W. T., et al, Science, Vol. 230, pp. 400-407 (1985)) with a short (17 amino acid) cytosolic domain at its amino terminus, a 15 amino acid transmembrane domain flanked by basic residues, and a 478 amino acid carboxyl-terminal domain. The sequence organization and membrane-spanning topology predicted for this protein are virtually identical to those predicted by the sequences of all mammalian glycosyltransferases cloned to date (Paulson, J. C., et al, J. Biol Chem., Vol. 264, pp. 17615-17618 (1989)). These considerations strongly suggest that the protein encoded by pCDM8-CT is a glycosyltransferase. They further indicate that the 478 residues at the carboxyl-terminus of the enzyme reside within the lumen of the Golgi apparatus and constitute the protein's catalytic domain.

This cloned cDNA hybridizes to a prominent 4.4 kb transcript in 14-7fd cells (FIG. 2). This indicates that cDNA we have isolated does not represent a full length transcript. Nonetheless, we believe we have isolated the entire coding region of this enzyme since this cDNA insert is capable of expressing an enzyme with functional catalytic activity corresponding to the murine CT-GalNAc-transferase (see below). The discrepancy between the transcript size and the cDNA can most probably be accounted for by an incomplete representation of the 5' and 3' untranslated regions, especially when considered with the fact that many mammalian glycosyltransferase transcripts contain extremely long 3' untranslated regions (Lowe, J. B., Sem. Cell Biol., Vol. 2, pp. 289-307 (1991)). However, this does not rule out the possibility that a less abundant smaller transcript from the 14-7fd library, which is not readily evident upon Northern blot analysis, has been cloned.

The protein encoded by pCDM8-CT is a UDP-GalNAc: NeuAc.alpha.2,3Gal.beta.-R .beta.1,4-GalNAc-transferase.

Flow cytometry analysis and enzyme assays were used to confirm that pCDM8-CT encodes a GalNAc-transferase capable of transferring GalNAc in a .beta.1,4-linkage to galactose in the presence of an .alpha.2,3-linked sialic acid. In the flow cytometry studies, plasmid pCDM8-CT, or a negative control vector (pCDM8), were transiently transfected into CHO-Tag cells, and the transfected cells were subsequently examined using antibodies and a lectin that recognize the NeuAc.alpha.2,3(GalNAc.beta.1,4)Gal.beta.-R structure (FIG. 3). CHO-Tag cells transfected with pCDM8-CT express epitopes recognized by the CT1 and CT2 monoclonal antibodies (FIG. 3), and also stain with a human alloantiserum that recognizes the human Sd.sup.a blood group determinant (Donald, A. S. R., et al, Biochem. Soc, trans., Vol. 15, pp. 606-608 (1987)) (FIG. 3). The transfected cells also stain brightly with two monoclonal antibodies (2A3D2 and 2D11E2) (Hiraiwa, N., et al, Cancer Res., Vol. 50, pp. 5497-5503 (1990)) shown previously to recognize the Sd.sup.a blood group on Ser/Thr-linked oligosaccharides, as well as the non-reducing terminal trisaccharide structure NeuAc .alpha.2,3(GalNAc.beta.1,4)Gal-R of glycolipids such as GM2 and GalNAc-GD1a (Hiraiwa, N., et al, Cancer Res., Vol. 50, pp. 5497-5503 (1990)). These cells also stained brightly with fluorescein isothiocyanate-conjugated Vicia villosa agglutinin (VVA), a GalNAc specific lectin that binds to wild type murine cytotoxic T-lymphocytes (Kimura, A. K., et al,, J. Exp. Med., Vol. 149, pp. 473-484 (1979). By contrast, a negative control IgM antibody directed against the human H blood group did not stain cells transfected with pCDM8-CT, nor did it stain cells transfected with the vector alone. These results demonstrate that the cDNA we have isolated is competent to construct the cell surface localized terminal carbohydrate structure NeuAc.alpha.2,3(GalNAc.beta.1,4)Gal-R.

Enzyme assays were used to obtain additional confirmatory evidence for this conclusion. These assays were conducted using microsomes isolated from CHO-Tag cells transiently transfected with pCDM8-CT, or from CHO-Tag cells transiently transfected with the vector pCDM8 alone. Microsomal fractions were tested for their ability to transfer GalNAc from the nucleotide donor sugar UDP-GalNAc to various acceptor substrates. As documented in FIG. 4, microsomes prepared from pCDM8-CT transfected cells were proficient at transferring GalNAc to the trisaccharide acceptor 3'-sialyl-N-acetyl-lactosamine, and generated the tetrasaccharide structure NeuAc.alpha.2,3(GalNAc.beta.1,4)Gal.beta.1,4GlcNAc (see below). However, this microsomal fraction did not utilize the unsialylated disaccharide N-acetyl-lactosamine at a detectable level. Identical results are obtained using a microsomal fraction prepared from the 14-7fd CTL line. This observation is in complete agreement with others' data concerning the in vitro enzymatic properties of the Sd.sup.a -GalNAc-transferase in human (Piller, F., et al, Carbohydrate Res., Vol. 149, pp. 171-184 (1986)) and guinea pig kidney (Serafini-Cessi, F., et al, Biochem. J., Vol, 215, pp. 483-489 (1983); Dall'olio, F., et al, Bioscience Reports, Vol. 7, pp. 925-932 (1987)), in human plasma (Takeya, A., et al, J. Biochem., Vol. 101, pp. 251-259 (1987)), and the CT-GalNAc-transferase in murine cytotoxic T-lymphocyte cell lines (Conzelmann, A., et al, J. Biol. Chem., Vol. 259, pp. 12528-12535 (1984); Conzelmann, A., et al, J. Biol. Chem., Vol. 259, pp. 12536-12542 (1984)). In addition, microsomes prepared from pCDM8-CT transfected cells are capable of efficiently transferring GalNAc to iminobiotinylated bovine fetuin (FIG. 4), but with a substantially reduced efficiency when iminobiotinylated asialofetuin is used (FIG. 4). Similar results are obtained when microsomal preparations from 14-7fd cells are used. The apparent activity observed with the asialo substrate is most probably a function of residual activity towards the small amount of incompletely desialylated fetuin molecules contaminating the desialylated preparation.

To confirm that the enzyme activity encoded by pCDM8-CT creates the tetrasaccharide NeuAc.alpha.2,3(GalNAc.beta.1,4)Gal.beta.1,4GlcNAc from the trisaccharide precursor NeuAc.alpha.2,3Gal.beta.1,4GlcNAc, we characterized the radiolabeled product formed from 3'-sialyl-N-acetyl-lactosamine and .sup.3 H-UDP-GalNAc. It was difficult to release the terminal N-acetyl-neuraminic acid from the in vitro .sup.3 H-GalNAc labeled product (a t.sub.1/2 of 27 minutes, as assessed by ion-exchange HPLC) using conditions (2N acetic acid at 100.degree. C.) that will typically yield complete release of terminal N-acetyl-neuraminic acid residues within 15 minutes (Green, E. D., et al, J. Biol Chem., Vol. 263, pp. 25-35 (1988)). The terminal N-acetyl-neuraminic acid moiety on the glycolipid GM2 is similarly resistant to acid hydrolysis (Wiegant, H. in Glycolipids (Wiegandt, J., Ed.) pp. 199-260, Elsevier, New York, N.Y. (1985)). This resistance is apparently a consequence of the presence of a 4-O-substituted GalNAc proximal to the 3-O substituted N-acetylneuraminic acid. The neuraminic acid on the .sup.3 H-GalNAc labeled product was also unusually resistant to all neuraminidases we tested. The product could be partially desialylated (10-50%) by digestion with neuraminidases from Clostridium perfringens, Vibrio cholera, and Newcastle Disease virus at a concentration five-fold higher than is required to completely desialylate .sup.3 H-galactose labeled 3'-sialyl-N-acetyl-lactosamine.

To further characterize the product, radiolabeled material present after acid-catalyzed desialylation (2N acetic acid, 100.degree. C., 45 minutes) was fractionated by ion-exchange HPLC (Baenziger, J. U., et al, Anal. Biochem., Vol. 112, pp. 357-361 (1981)). The neutral fraction (.about.80% of input material) was subjected to digestion with either jack bean .beta.-N-acetylhexoseaminidase, or with .alpha.-N-acetylhexoseaminidase. .beta.-N-acetylhexoseaminidase digestion quantitatively released radiolabel from the desialylated product. The released radiolabel co-migrated with an N-acetylgalactosamine standard on a Bio-Rad HPX-87H organic acid HPLC column. The non-desialylated product was completely resistant to digestion with .beta.-N-acetylhexoseaminidase. The desialylated neutral product was completely resistant to .alpha.-N-acetylhexoseaminidase digestion. Taken together, these observations demonstrate that the galactose moiety on the sialylated acceptor molecule has been substituted with GalNAc at the 4-hydroxyl, and thus supports the conclusion that the enzyme encoded by pCDM8-CT catalyzes the addition of GalNAc in .beta.1,4-linkage to the galactose moiety of 3'-sialyl-N-acetyl-lactosamine, to form NeuAc.alpha.2,3(GalNAc.beta.1,4)Gal.beta.1,4GlcNAc.

To formally demonstrate that the present cDNA encodes the .beta.1,4-GalNAc-transferase activity characterized above, and that it does not instead yield a tran-sacting molecule capable of generating this activity through interaction with endogenous CHO molecules, a mammalian expression vector (pPROTA-CT.sub.c) that encodes a chimeric recombinant protein in which amino acid residues corresponding to the enzyme's putative catalytic domain are fused to a secretable form of the IgG binding domain of Staphylococcus aureus protein A (Sanchez-Lopez, R., et al, J. Biol. Chem., Vol. 263, pp. 11892-11899 (1988)) was constructed. This vector was transfected into CHO-Tag cells and tested for its ability to generate a soluble, IgG-binding, GalNAc-transferase activity. Of the total recovered GalNAc-transferase activity produced by an aliquot of pPROTA-CT.sub.c -transfected cells, 99% of the GalNAc-transferase activity was found in the culture media (Table I). Interestingly, cells transfected with the vector encoding the full-length, wild type enzyme (pCDM8-CT) also directed most of the enzyme activity to the culture media (92% of the total recovered activity; Table I), as has been observed in similar experiments with other mammalian glycosyltransferases (for example, see Kukowska-Latallo, J. F., et al, Genes & Dev., Vol. 4, pp. 1288-1303 (1990)).

The activity recovered from the media of pPROTA-CT.sub.c -transfected CHO-Tag cells was applied either to an lgG-Sepharose matrix, or to a control Sepharose 4B preparation. The matrices were then thoroughly washed, and the amount of GalNAc-transferase activity present in the combined supernatant and wash fractions, or on the matrices themselves, was determined. As shown in Table IB, the activity applied to IgG-Sepharose was almost completely absorbed from the media, and 37% of the applied activity could be detected directly linked to the IgG-Sepharose beads. The activity applied to Sepharose 4B was quantitatively recovered in the supernatant and wash fraction, and no activity could be detected linked to the Sepharose beads. None of the activity generated by the plasmid vector pCDM8-CT bound to either matrix. These results demonstrate that this cloned cDNA encodes a .beta.1,4-GalNAc-transferase and show that the peptide sequence information necessary to the enzyme's catalytic activity lies within the 476 amino acids distal to the putative trans-membrane domain.

                  TABLE 1
    ______________________________________
    Soluble and cell-associated GalNAc-transferase
    activities
    ______________________________________
    A. Released versus cell-associated GalNAc-transferase activity
                 Cell-associated
                            Released activity
    Vector       activity (units)
                            (units)
    ______________________________________
    pCDM8-CT     719.7      8390 (92% of total)
    pCPROTA-CT.sub.c
                 69.2       9828 (99% of total)
    ______________________________________
    B. Affinity chromatography of protein A-GalNAc-transferase
    fusion protein (pPROTA-CT.sub.c) measured as units of total
    activity
    Chromatography
    matrix      applied    flowthrough
                                     bound
    ______________________________________
    Sepharose   4914       4959      none
    Sepharose-IgG
                4914        214      1853
    ______________________________________


CHO-Tag cells were transfected with pCDM8-CT, or with pROTA-CT.sub.c. (A) After a 68-hour expression period, media and cell extracts were assayed for GalNAc-transferase activity as described. The total activity found in cell extracts prepared from an entire plate of transfected cells is denoted "Cell-associated activity", whereas the total activity found in the processed media harvested from the same plate is termed "released activity". (B) An aliquot of the conditioned media recovered from CHO-Tag cells transfected with pPROTA-CT.sub.c was assayed to determine its content of GalNAc-transferase activity. Aliquots of media containing equal amounts of this activity ("applied" activity) were then subjected to chromatography on either Sepharose-IgG or on Sepharose 6B. GalNAc-transferase activity was determined on the material that flowed through the matrices ("flowthrough" activity), and on the material that remained bound to the matrices ("bound" activity), as described. One unit of transferase represents the amount of enzyme that can transfer one pmole of GalNAc to 189 .mu.g of iminobiotinylated fetuin during a 90 minute incubation period, at a UDP-GalNAc concentration of 20 .mu.M under standard assay conditions, after correction for background transfer of GalNAc to 189 .mu.g of iminobiotinylated asialofetuin.

The CT-GalNAc-transferase shares a substantial amount of nucleotide and protein sequence identity with the human GM2/GD2 synthase.

A search of the Genbank sequence database with the CT-GalNAc-transferase cDNA identified no entries with significant sequence similarity. However, we performed a direct comparison of the CT-GalNAc-transferase cDNA to a recently cloned cDNA encoding the human GM2/GD2 synthase (Nagata Y., et al, J. Biol. Chem., pp. 12082-12089 (1992)), since this latter enzyme also transfers GalNAc in .beta.1,4-linkage to the NeuAc.alpha.2,3Gal.beta.1,4Glc-R moiety (of GM3) to generate the structure NeuAc.alpha.2,3(GalNAc.beta.1,4)Gal.beta.1,4Glc-Ceramide. It was found that the CT-GalNAc-transferase maintains a substantial amount of DNA sequence identity with the human GM2/GD2 synthase cDNA (51% identity; FIGS. 5A, 5B, and 5C). The derived protein sequences of the two enzymes also share substantial amounts of protein sequence identity. We found that amino acid sequence similarity between these two proteins could be maximized by conceptually adding two bases to the published human GM2/GD2 synthase cDNA sequence, one at a position immediately after nucleotide 1295, and another immediately after nucleotide 1414 (bold type, FIGS. 5A, 5B, and 5C). To determine if these conceptual additions could be justified by correction of errors in the published human GM2/GD2 synthase cDNA sequence, we amplified a 500 nucleotide segment of the human GM2/GD2 synthase cDNA from a human melanoma cell (M21) (Mueller, B. M., et al, Proc. Natl. Acad. Sci. U.S.A., Vol. 87, pp. 5702-5705 (1990)) cDNA library and determined its sequence. We found that this segment of the human GM2/GD2 synthase cDNA does contain two additional nucleotides at these positions (cytidines, in each case) (FIG. 6). Insertion of these two nucleotides yields a corrected translational reading frame for GM2/GD2 synthase that is collinear with the reading frame predicted by the CT-GalNAc-transferase cDNA, and yields a predicted GM2/GD2 synthase amino acid sequence that shares 44% identity with the murine CT-GalNAc-transferase, with maximal similarity through the regions corresponding to these enzymes' COOH-terminal catalytic domains (FIGS. 5A, 5B, and 5C).

Southern analysis of murine genomic DNA.

Southern blot analyses were used to help determine if the murine CT-GalNAc-transferase cDNA corresponds to a unique gene, or if it can cross-hybridize with other similar sequences, including murine GM2/GD2 synthase gene(s). Southern blots containing murine genomic DNA were hybridized at low stringency with a probe corresponding to nucleotides 523-1090 of the CT-GalNAc-transferase cDNA or with a probe derived from the corresponding region of the human GM2/GD2 synthase cDNA (nucleotides 580-1144; FIG. 6). These two probes correspond to regions of their respective cDNAs that are most similar in nucleotide and amino acid sequence. Each probe hybridized with a unique set of DNA restriction fragments under low stringency hybridization and wash conditions, despite the substantial amount of primary sequence similarity displayed by the two probes (FIG. 7). The pattern of hybridizing fragments remained the same after washing the blots under high stringency conditions. These results demonstrate that the murine CT-GalNAc-transferase gene is distinct from a murine sequence homologous to the human GM2/GD2 synthase gene.

Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that, within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.

    __________________________________________________________________________
    SEQUENCE LISTING
    (1) GENERAL INFORMATION:
    (iii) NUMBER OF SEQUENCES: 14
    (2) INFORMATION FOR SEQ ID NO:1:
    (i) SEQUENCE CHARACTERISTICS:
    (A) LENGTH: 1624 base pairs
    (B) TYPE: nucleic acid
    (C) STRANDEDNESS: double
    (D) TOPOLOGY: linear
    (ii) MOLECULE TYPE: DNA
    (ix) FEATURE:
    (A) NAME/KEY: CDS
    (B) LOCATION: 42..1574
    (ix) FEATURE:
    (A) NAME/KEY: 5'UTR
    (B) LOCATION: 1..41
    (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
    CTGCGGTAGGCAGTCTGCAGAAGTGGCTGGAGCGAGCTGCGATGACTTCCAGC53
    MetThrSerSer
    GTGTCTTTTGCCAGCTTCAGGTTTCCATGGCTCCTCAAGACATTTGTC101
    ValSerPheAlaSerPheArgPheProTrpLeuLeuLysThrPheVal
    5101520
    CTCATGGTAGGACTTGCCACTGTTGCGTTTATGGTGAGAAAGGTGTCC149
    LeuMetValGlyLeuAlaThrValAlaPheMetValArgLysValSer
    253035
    CTTACAACAGACTTCAGCACCTTCAAGCCAAAGTTTCCAGAGCCTGCA197
    LeuThrThrAspPheSerThrPheLysProLysPheProGluProAla
    404550
    AGGGTTGACCCAGTGCTGAAGCTTCTACCAGAGGAGCATCTGAGGAAA245
    ArgValAspProValLeuLysLeuLeuProGluGluHisLeuArgLys
    556065
    CTCTTTACCTACAGTGACATCTGGCTCTTCCCCAAAAATCAGTGTGAC293
    LeuPheThrTyrSerAspIleTrpLeuPheProLysAsnGlnCysAsp
    707580
    TGTAACTCTGGCAAACTGCGAATGAAATATAAGTTTCAGGATGCCTAT341
    CysAsnSerGlyLysLeuArgMetLysTyrLysPheGlnAspAlaTyr
    859095100
    AACCAGAAGGACCTTCCAGCTGTGAATGCCAGAAGACAGGCAGAATTT389
    AsnGlnLysAspLeuProAlaValAsnAlaArgArgGlnAlaGluPhe
    105110115
    GAGCACTTTCAGAGGAGAGAAGGGCTGCCTCGCCCACCACCTCTGCTG437
    GluHisPheGlnArgArgGluGlyLeuProArgProProProLeuLeu
    120125130
    GCTCCACCCAATCTCCCCTTCGGATACCCAGTCCATGGTGTGGAGGTG485
    AlaProProAsnLeuProPheGlyTyrProValHisGlyValGluVal
    135140145
    ATGCCCCTGCATACAATTCTCATCCCAGGCCTCCAGTATGAAGGGCCA533
    MetProLeuHisThrIleLeuIleProGlyLeuGlnTyrGluGlyPro
    150155160
    GATGCTCCAGTCTATGAGGTCATCCTGAAAGCTTCTCTGGGGACACTG581
    AspAlaProValTyrGluValIleLeuLysAlaSerLeuGlyThrLeu
    165170175180
    AACACCCTTGCTGATGTGCCAGATGATGAGGTTCAGGGCAGAGGCCAG629
    AsnThrLeuAlaAspValProAspAspGluValGlnGlyArgGlyGln
    185190195
    AGGCAGCTGACCATTTCCACCAGACATCGGAAGGTCCTGAATTTCATC677
    ArgGlnLeuThrIleSerThrArgHisArgLysValLeuAsnPheIle
    200205210
    CTTCAGCATGTGACGTACACCAGCACAGAGTACTATCTCCACAAGGTG725
    LeuGlnHisValThrTyrThrSerThrGluTyrTyrLeuHisLysVal
    215220225
    GACACAGTAAGTATGGAATACGAGTCGTCAGTGGCCAAGTTTCCAGTG773
    AspThrValSerMetGluTyrGluSerSerValAlaLysPheProVal
    230235240
    ACTATCAAACAACAGACTGTACCCAAGTTGTATGACCCTGGACCTGAG821
    ThrIleLysGlnGlnThrValProLysLeuTyrAspProGlyProGlu
    245250255260
    AGGAAGATCAGAAACCTGGTGACCATTGCCACGAAGACTTTTCTCCGT869
    ArgLysIleArgAsnLeuValThrIleAlaThrLysThrPheLeuArg
    265270275
    CCCCACAAGCTTAAGATCCTGCTTCAGAGTATTCGAAAATATTACCCA917
    ProHisLysLeuLysIleLeuLeuGlnSerIleArgLysTyrTyrPro
    280285290
    GACATTACCGTGATTGTAGCTGATGACAGCAAGGAGCCCCTGGAAATT965
    AspIleThrValIleValAlaAspAspSerLysGluProLeuGluIle
    295300305
    AATGATGACTACGTGGAGTACTACACCATGCCCTTTGGGAAGGGCTGG1013
    AsnAspAspTyrValGluTyrTyrThrMetProPheGlyLysGlyTrp
    310315320
    TTTGCTGGGAGGAACCTGGCCATCTCACAGGTGACTACTAAATATGTC1061
    PheAlaGlyArgAsnLeuAlaIleSerGlnValThrThrLysTyrVal
    325330335340
    CTCTGGGTGGACGATGACTTTCTCTTCAGCGACAAGACCAAGATTGAG1109
    LeuTrpValAspAspAspPheLeuPheSerAspLysThrLysIleGlu
    345350355
    GTACTGGTGGATGTCCTGGAGAAAACCGAACTGGATGTGGTGGGCGGC1157
    ValLeuValAspValLeuGluLysThrGluLeuAspValValGlyGly
    360365370
    AGCGTGCAGGGGAATACTTACCAGTTCAGGCTGCTGTATGAACAGACC1205
    SerValGlnGlyAsnThrTyrGlnPheArgLeuLeuTyrGluGlnThr
    375380385
    AAGAATGGGAGCTGTCTTCACCAGAGGTGGGGATCATTCCAGGCCCTT1253
    LysAsnGlySerCysLeuHisGlnArgTrpGlySerPheGlnAlaLeu
    390395400
    GACGGCTTTCCCGGATGCACGTTGACCAGCGGCGTGGTGAACTTCTTC1301
    AspGlyPheProGlyCysThrLeuThrSerGlyValValAsnPhePhe
    405410415420
    TTGGCTCACACGGAACAACTCCGAAGAGTTGGTTTTGATCCCATCTTG1349
    LeuAlaHisThrGluGlnLeuArgArgValGlyPheAspProIleLeu
    425430435
    CAACGAGTGGCCCACGGAGAGTTCTTTATTGATGGGCTGGGGAGACTG1397
    GlnArgValAlaHisGlyGluPhePheIleAspGlyLeuGlyArgLeu
    440445450
    TTGGTGGGCTCTTGCCCGGGTGTAATTATAAACCACCAAGTAAGAACA1445
    LeuValGlySerCysProGlyValIleIleAsnHisGlnValArgThr
    455460465
    CCACCAAAGGATCCAAAGCTGGCTGCCTTGGAGAAGACTTATGACAAA1493
    ProProLysAspProLysLeuAlaAlaLeuGluLysThrTyrAspLys
    470475480
    TACCGGGCCAACACCAATTCTGTGATCCAATTCAAGGTTGCACTCCAG1541
    TyrArgAlaAsnThrAsnSerValIleGlnPheLysValAlaLeuGln
    485490495500
    TACTTCAAGAACCATCTCTACTGCTCCACTTAAAAAGTACCAAGACCAGG1591
    TyrPheLysAsnHisLeuTyrCysSerThr
    505510
    AATCGCAATAAACAGATTAGCGGCGGGCAACAA1624
    (2) INFORMATION FOR SEQ ID NO:2:
    (i) SEQUENCE CHARACTERISTICS:
    (A) LENGTH: 510 amino acids
    (B) TYPE: amino acid
    (D) TOPOLOGY: linear
    (ii) MOLECULE TYPE: protein
    (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
    MetThrSerSerValSerPheAlaSerPheArgPheProTrpLeuLeu
    151015
    LysThrPheValLeuMetValGlyLeuAlaThrValAlaPheMetVal
    202530
    ArgLysValSerLeuThrThrAspPheSerThrPheLysProLysPhe
    354045
    ProGluProAlaArgValAspProValLeuLysLeuLeuProGluGlu
    505560
    HisLeuArgLysLeuPheThrTyrSerAspIleTrpLeuPheProLys
    65707580
    AsnGlnCysAspCysAsnSerGlyLysLeuArgMetLysTyrLysPhe
    859095
    GlnAspAlaTyrAsnGlnLysAspLeuProAlaValAsnAlaArgArg
    100105110
    GlnAlaGluPheGluHisPheGlnArgArgGluGlyLeuProArgPro
    115120125
    ProProLeuLeuAlaProProAsnLeuProPheGlyTyrProValHis
    130135140
    GlyValGluValMetProLeuHisThrIleLeuIleProGlyLeuGln
    145150155160
    TyrGluGlyProAspAlaProValTyrGluValIleLeuLysAlaSer
    165170175
    LeuGlyThrLeuAsnThrLeuAlaAspValProAspAspGluValGln
    180185190
    GlyArgGlyGlnArgGlnLeuThrIleSerThrArgHisArgLysVal
    195200205
    LeuAsnPheIleLeuGlnHisValThrTyrThrSerThrGluTyrTyr
    210215220
    LeuHisLysValAspThrValSerMetGluTyrGluSerSerValAla
    225230235240
    LysPheProValThrIleLysGlnGlnThrValProLysLeuTyrAsp
    245250255
    ProGlyProGluArgLysIleArgAsnLeuValThrIleAlaThrLys
    260265270
    ThrPheLeuArgProHisLysLeuLysIleLeuLeuGlnSerIleArg
    275280285
    LysTyrTyrProAspIleThrValIleValAlaAspAspSerLysGlu
    290295300
    ProLeuGluIleAsnAspAspTyrValGluTyrTyrThrMetProPhe
    305310315320
    GlyLysGlyTrpPheAlaGlyArgAsnLeuAlaIleSerGlnValThr
    325330335
    ThrLysTyrValLeuTrpValAspAspAspPheLeuPheSerAspLys
    340345350
    ThrLysIleGluValLeuValAspValLeuGluLysThrGluLeuAsp
    355360365
    ValValGlyGlySerValGlnGlyAsnThrTyrGlnPheArgLeuLeu
    370375380
    TyrGluGlnThrLysAsnGlySerCysLeuHisGlnArgTrpGlySer
    385390395400
    PheGlnAlaLeuAspGlyPheProGlyCysThrLeuThrSerGlyVal
    405410415
    ValAsnPhePheLeuAlaHisThrGluGlnLeuArgArgValGlyPhe
    420425430
    AspProIleLeuGlnArgValAlaHisGlyGluPhePheIleAspGly
    435440445
    LeuGlyArgLeuLeuValGlySerCysProGlyValIleIleAsnHis
    450455460
    GlnValArgThrProProLysAspProLysLeuAlaAlaLeuGluLys
    465470475480
    ThrTyrAspLysTyrArgAlaAsnThrAsnSerValIleGlnPheLys
    485490495
    ValAlaLeuGlnTyrPheLysAsnHisLeuTyrCysSerThr
    500505510
    (2) INFORMATION FOR SEQ ID NO:3:
    (i) SEQUENCE CHARACTERISTICS:
    (A) LENGTH: 1086 base pairs
    (B) TYPE: nucleic acid
    (C) STRANDEDNESS: single
    (D) TOPOLOGY: linear
    (ii) MOLECULE TYPE: cDNA
    (ix) FEATURE:
    (A) NAME/KEY: CDS
    (B) LOCATION: 1..1086
    (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
    GCCTATAACCAGAAGGACCTTCCAGCTGTGAATGCCAGAAGACAGGCA48
    AlaTyrAsnGlnLysAspLeuProAlaValAsnAlaArgArgGlnAla
    151015
    GAATTTGAGCACTTTCAGAGGAGAGAAGGGCTGCCTCGCCCACCACCT96
    GluPheGluHisPheGlnArgArgGluGlyLeuProArgProProPro
    202530
    CTGCTGGCTCCACCCAATCTCCCCTTCGGATACCCAGTCCATGGTGTG144
    LeuLeuAlaProProAsnLeuProPheGlyTyrProValHisGlyVal
    354045
    GAGGTGATGCCCCTGCATACAATTCTCATCCCAGGCCTCCAGTATGAA192
    GluValMetProLeuHisThrIleLeuIleProGlyLeuGlnTyrGlu
    505560
    GGGCCAGATGCTCCAGTCTATGAGGTCATCCTGAAAGCTTCTCTGGGG240
    GlyProAspAlaProValTyrGluValIleLeuLysAlaSerLeuGly
    65707580
    ACACTGAACACCCTTGCTGATGTGCCAGATGATGAGGTTCAGGGCAGA288
    ThrLeuAsnThrLeuAlaAspValProAspAspGluValGlnGlyArg
    859095
    GGCCAGAGGCAGCTGACCATTTCCACCAGACATCGGAAGGTCCTGAAT336
    GlyGlnArgGlnLeuThrIleSerThrArgHisArgLysValLeuAsn
    100105110
    TTCATCCTTCAGCATGTGACGTACACCAGCACAGAGTACTATCTCCAC384
    PheIleLeuGlnHisValThrTyrThrSerThrGluTyrTyrLeuHis
    115120125
    AAGGTGGACACAGTAAGTATGGAATACGAGTCGTCAGTGGCCAAGTTT432
    LysValAspThrValSerMetGluTyrGluSerSerValAlaLysPhe
    130135140
    CCAGTGACTATCAAACAACAGACTGTACCCAAGTTGTATGACCCTGGA480
    ProValThrIleLysGlnGlnThrValProLysLeuTyrAspProGly
    145150155160
    CCTGAGAGGAAGATCAGAAACCTGGTGACCATTGCCACGAAGACTTTT528
    ProGluArgLysIleArgAsnLeuValThrIleAlaThrLysThrPhe
    165170175
    CTCCGTCCCCACAAGCTTAAGATCCTGCTTCAGAGTATTCGAAAATAT576
    LeuArgProHisLysLeuLysIleLeuLeuGlnSerIleArgLysTyr
    180185190
    TACCCAGACATTACCGTGATTGTAGCTGATGACAGCAAGGAGCCCCTG624
    TyrProAspIleThrValIleValAlaAspAspSerLysGluProLeu
    195200205
    GAAATTAATGATGACTACGTGGAGTACTACACCATGCCCTTTGGGAAG672
    GluIleAsnAspAspTyrValGluTyrTyrThrMetProPheGlyLys
    210215220
    GGCTGGTTTGCTGGGAGGAACCTGGCCATCTCACAGGTGACTACTAAA720
    GlyTrpPheAlaGlyArgAsnLeuAlaIleSerGlnValThrThrLys
    225230235240
    TATGTCCTCTGGGTGGACGATGACTTTCTCTTCAGCGACAAGACCAAG768
    TyrValLeuTrpValAspAspAspPheLeuPheSerAspLysThrLys
    245250255
    ATTGAGGTACTGGTGGATGTCCTGGAGAAAACCGAACTGGATGTGGTG816
    IleGluValLeuValAspValLeuGluLysThrGluLeuAspValVal
    260265270
    GGCGGCAGCGTGCAGGGGAATACTTACCAGTTCAGGCTGCTGTATGAA864
    GlyGlySerValGlnGlyAsnThrTyrGlnPheArgLeuLeuTyrGlu
    275280285
    CAGACCAAGAATGGGAGCTGTCTTCACCAGAGGTGGGGATCATTCCAG912
    GlnThrLysAsnGlySerCysLeuHisGlnArgTrpGlySerPheGln


290295300 GCCCTTGACGGCTTTCCCGGATGCACGTTGACCAGCGGCGTGGTGAAC960 AlaLeuAspGlyPheProGlyCysThrLeuThrSerGlyValValAsn 305310315320 TTCTTCTTGGCTCACACGGAACAACTCCGAAGAGTTGGTTTTGATCCC1008 PhePheLeuAlaHisThrGluGlnLeuArgArgValGlyPheAspPro 325330335 ATCTTGCAACGAGTGGCCCACGGAGAGTTCTTTATTGATGGGCTGGGG1056 IleLeuGlnArgValAlaHisGlyGluPhePheIleAspGlyLeuGly 340345350 AGACTGTTGGTGGGCTCTTGCCCGGGTGTA1086 ArgLeuLeuValGlySerCysProGlyVal 355360 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 362 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: AlaTyrAsnGlnLysAspLeuProAlaValAsnAlaArgArgGlnAla 151015 GluPheGluHisPheGlnArgArgGluGlyLeuProArgProProPro 202530 LeuLeuAlaProProAsnLeuProPheGlyTyrProValHisGlyVal 354045 GluValMetProLeuHisThrIleLeuIleProGlyLeuGlnTyrGlu 505560 GlyProAspAlaProValTyrGluValIleLeuLysAlaSerLeuGly 65707580 ThrLeuAsnThrLeuAlaAspValProAspAspGluValGlnGlyArg 859095 GlyGlnArgGlnLeuThrIleSerThrArgHisArgLysValLeuAsn 100105110 PheIleLeuGlnHisValThrTyrThrSerThrGluTyrTyrLeuHis 115120125 LysValAspThrValSerMetGluTyrGluSerSerValAlaLysPhe 130135140 ProValThrIleLysGlnGlnThrValProLysLeuTyrAspProGly 145150155160 ProGluArgLysIleArgAsnLeuValThrIleAlaThrLysThrPhe 165170175 LeuArgProHisLysLeuLysIleLeuLeuGlnSerIleArgLysTyr 180185190 TyrProAspIleThrValIleValAlaAspAspSerLysGluProLeu 195200205 GluIleAsnAspAspTyrValGluTyrTyrThrMetProPheGlyLys 210215220 GlyTrpPheAlaGlyArgAsnLeuAlaIleSerGlnValThrThrLys 225230235240 TyrValLeuTrpValAspAspAspPheLeuPheSerAspLysThrLys 245250255 IleGluValLeuValAspValLeuGluLysThrGluLeuAspValVal 260265270 GlyGlySerValGlnGlyAsnThrTyrGlnPheArgLeuLeuTyrGlu 275280285 GlnThrLysAsnGlySerCysLeuHisGlnArgTrpGlySerPheGln 290295300 AlaLeuAspGlyPheProGlyCysThrLeuThrSerGlyValValAsn 305310315320 PhePheLeuAlaHisThrGluGlnLeuArgArgValGlyPheAspPro 325330335 IleLeuGlnArgValAlaHisGlyGluPhePheIleAspGlyLeuGly 340345350 ArgLeuLeuValGlySerCysProGlyVal 355360 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1125 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1125 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: GCCTTTGACCCTGCAGAGCTGAGGGCTGCCTCTGCCACAAGAGAGCAG48 AlaPheAspProAlaGluLeuArgAlaAlaSerAlaThrArgGluGln 151015 GAGTTCCAGGCCTTTCTGTCGAGGAGCCAGTCCCCAGCTGACCAGCTG96 GluPheGlnAlaPheLeuSerArgSerGlnSerProAlaAspGlnLeu 202530 CTCATAGCCCCTGCCAACTCCCCGCTCCAGTACCCCCTACAGGGTGTG144 LeuIleAlaProAlaAsnSerProLeuGlnTyrProLeuGlnGlyVal 354045 GAAGTTCAGCCCCTCAGGAGCATCTTGGTGCCAGGGCTGAGCCTTCAG192 GluValGlnProLeuArgSerIleLeuValProGlyLeuSerLeuGln 505560 GCAGCTTCTGGTCAGGAGGTATACCAGGTGAACCTGACTGCCTCCCTA240 AlaAlaSerGlyGlnGluValTyrGlnValAsnLeuThrAlaSerLeu 65707580 GGCACCTGGGACGTGGCAGGGGAAGTGACTGGAGTTACTCTCACTGGA288 GlyThrTrpAspValAlaGlyGluValThrGlyValThrLeuThrGly 859095 GAGGGTCAGGCAGATCTCACCCTTGTCAGCCCAGGGCTGGACCAACTC336 GluGlyGlnAlaAspLeuThrLeuValSerProGlyLeuAspGlnLeu 100105110 AACAGGCAACTACAACTGGTCACTTACAGCAGCCGAAGCTACCAGACC384 AsnArgGlnLeuGlnLeuValThrTyrSerSerArgSerTyrGlnThr 115120125 AACACAGCAGACACAGTCCGGTTCTCCACCGAGGGACATGAGGCTGCT432 AsnThrAlaAspThrValArgPheSerThrGluGlyHisGluAlaAla 130135140 TTCACTATCCGCATAAGACACCCGCCCAACCCTCGGCTGTACCCACCT480 PheThrIleArgIleArgHisProProAsnProArgLeuTyrProPro 145150155160 GGGTCTCTACCCCAGGGAGCCCAGTACAACATCAGCGCTCTAGTCACG528 GlySerLeuProGlnGlyAlaGlnTyrAsnIleSerAlaLeuValThr 165170175 ATTGCCACCAAGACCTTCCTCCGTTATGATCGGCTACGGGCTCTCATC576 IleAlaThrLysThrPheLeuArgTyrAspArgLeuArgAlaLeuIle 180185190 ACCAGTATCCGCCGCTTCTACCCAACGGTTACCGTGGTCATCGCTGAC624 ThrSerIleArgArgPheTyrProThrValThrValValIleAlaAsp 195200205 GACAGCGACAAGCCAGAGCGCGTTAGTGGCCCCTACGTGGAACACTAT672 AspSerAspLysProGluArgValSerGlyProTyrValGluHisTyr 210215220 CTCATGCCCTTCGGCAAGGGCTGGTTCGCAGGCCGGAACCTGGCCGTG720 LeuMetProPheGlyLysGlyTrpPheAlaGlyArgAsnLeuAlaVal 225230235240 TCTCAAGTAACCACCAAGTACGTGCTGTGGGTGGACGACGACTTCGTC768 SerGlnValThrThrLysTyrValLeuTrpValAspAspAspPheVal 245250255 TTCACGGCGCGGACGCGGCTGGAGAGGCTTGTGGACGTGCTGGAGCGG816 PheThrAlaArgThrArgLeuGluArgLeuValAspValLeuGluArg 260265270 ACGCCGCTGGACCTGGTGGGGGGCGCGGTGCGCGAGATCTCCGGCTTT864 ThrProLeuAspLeuValGlyGlyAlaValArgGluIleSerGlyPhe 275280285 GCCACCACTTATCGGCAGCTGCTGAGCGTGGAGCCCGGCGCCCCAGGC912 AlaThrThrTyrArgGlnLeuLeuSerValGluProGlyAlaProGly 290295300 CTCGGGAACTGCCTCCGGCAAAGGCGCGGCTTCCACCACGAGCTCGTC960 LeuGlyAsnCysLeuArgGlnArgArgGlyPheHisHisGluLeuVal 305310315320 GGCTTCCCAGGCTGCGTGGTCACCGACGGCGTGGTTAACTTCTTCCTG1008 GlyPheProGlyCysValValThrAspGlyValValAsnPhePheLeu 325330335 GCGCGGACTGACAAGGTGCGCGAGGTCGGTTTCGACCCCCGCCTCAGC1056 AlaArgThrAspLysValArgGluValGlyPheAspProArgLeuSer 340345350 CGCGTGGCTCATCTGGAATTCTTCTTGGATGGGCTTGGTTCCCTTCGG1104 ArgValAlaHisLeuGluPhePheLeuAspGlyLeuGlySerLeuArg 355360365 GTTGGCTCCTGCTCCGACGTC1125 ValGlySerCysSerAspVal 370375 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 375 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: AlaPheAspProAlaGluLeuArgAlaAlaSerAlaThrArgGluGln 151015 GluPheGlnAlaPheLeuSerArgSerGlnSerProAlaAspGlnLeu 202530 LeuIleAlaProAlaAsnSerProLeuGlnTyrProLeuGlnGlyVal 354045 GluValGlnProLeuArgSerIleLeuValProGlyLeuSerLeuGln 505560 AlaAlaSerGlyGlnGluValTyrGlnValAsnLeuThrAlaSerLeu 65707580 GlyThrTrpAspValAlaGlyGluValThrGlyValThrLeuThrGly 859095 GluGlyGlnAlaAspLeuThrLeuValSerProGlyLeuAspGlnLeu 100105110 AsnArgGlnLeuGlnLeuValThrTyrSerSerArgSerTyrGlnThr 115120125 AsnThrAlaAspThrValArgPheSerThrGluGlyHisGluAlaAla 130135140 PheThrIleArgIleArgHisProProAsnProArgLeuTyrProPro 145150155160 GlySerLeuProGlnGlyAlaGlnTyrAsnIleSerAlaLeuValThr 165170175 IleAlaThrLysThrPheLeuArgTyrAspArgLeuArgAlaLeuIle 180185190 ThrSerIleArgArgPheTyrProThrValThrValValIleAlaAsp 195200205 AspSerAspLysProGluArgValSerGlyProTyrValGluHisTyr 210215220 LeuMetProPheGlyLysGlyTrpPheAlaGlyArgAsnLeuAlaVal 225230235240 SerGlnValThrThrLysTyrValLeuTrpValAspAspAspPheVal 245250255 PheThrAlaArgThrArgLeuGluArgLeuValAspValLeuGluArg 260265270 ThrProLeuAspLeuValGlyGlyAlaValArgGluIleSerGlyPhe 275280285 AlaThrThrTyrArgGlnLeuLeuSerValGluProGlyAlaProGly 290295300 LeuGlyAsnCysLeuArgGlnArgArgGlyPheHisHisGluLeuVal 305310315320 GlyPheProGlyCysValValThrAspGlyValValAsnPhePheLeu 325330335 AlaArgThrAspLysValArgGluValGlyPheAspProArgLeuSer 340345350 ArgValAlaHisLeuGluPhePheLeuAspGlyLeuGlySerLeuArg 355360365 ValGlySerCysSerAspVal 370375 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GCGCCTCGAGGTATACCAGGTGAACCTGACTGCCTCC37 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: GCGCTCGAGTGAAGACGAAGTCGTCGTCCACCC33 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: GCGCTCGAGCCACTTATCGGCAGCTGCTGAGCGTGGAGC39 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: GCGCCTCGAGTGCTCACAGGGTGGTGGGGTTTGTTGG37 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: CGCGAATTCGGTGTCCCTTACAACAGACTTCAGCACC37 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: CGCGAATTCGGTACTTTTTAAGTGGAGCAGTAGAGATGG39 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: CTGCCTCCGGC11 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: CGACCCCCGCC11 __________________________________________________________________________

Gravity particle separator

Article transferring apparatus

Unitary key holder

Fuel system

Insulating insert for magnetic valves

Modular station platform construction kit

Surface modifier composition

Aqueous coating composition

Isothiazole and isoxazole sulphoxides

Plastic orientation measurement instrument

Compartmentalized basket truck

Cervical traction device

Terminal grounding unit

Manual floor sweeper

Selective hydrogenation of olefins

Glass compositions

Passive lavatory cleanser dispensing system

Non-aqueous electrochemical cell

Master cylinder apparatus

Seal press

Stacker bundler shuttle system

Depth-resolved fluorescence instrument

Power-generating control apparatus for vehicle

Multiple unit cigarette package

Sliding exhaust brake system

Golf club stand device

Somatostatin receptors

Electrical coupling unit for electrosurgery

Magnetic domain propagation register

Facial sun block mask

Moisture-curing polyamides

Substitute milk fat compositions

Process for decoking catalysts

Digital phase comparison apparatus

Arrangement for moving an object

Tricyclic amides

Multipurpose exercising apparatus

Production of dihydroxydiphenyl alkanes

Wearable display

Magnetic blanket for horses

Valve timing adjusting device

Extrusion machine

Pest bait station

Pulse width modulation operation circuit

Preparation of star polymers

Security and deployment assembly

Light distribution device

Shot gun shell tracer wad

Solar thermal propulsion unit

Variable delay memory system

Portable foldable splint

Plain bearing

Elongated flexible detonating device

Hard surface detergent composition

Modular nuclear fuel assembly design

Splash guard

High temperature diesel deposit tester

Motor vehicle wiper

Cover connecting mechanism

Expandable tire building former

Developing unit for electro-photographic apparatus

Wheelchair motorizing apparatus

Golf putt training apparatus

Simultaneous telecommunication between radio stations

Optical device, system and method

Laterally supported flexible sign

Heterocyclic-methylene-penems

Thin layer ablation apparatus

Brake pressure control valve

Impact-resisting composites

Preparation of 2-amino-4-fluoropyrimidine derivatives

Paint toning machine

Drum construction

Output regulator

Aerobic exercise device

Imidazodiazepine derivative

Polishing apparatus

Electromechanical preparation of photoengraving cylinders

Tissue anchoring system and method

Actuator and actuator system

Fuel system for multicylinder engines

Printer control system

Method for purifying acetone

Flash memory device

Gypsum-cement system for construction materials

Clothes hanger

Automatic reversal mechanism